Gene/Protein Characteristic Table for KIAA0790
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06730
Accession No AB018333
Description SAM and SH3 domain containing 1
Clone name hk05609
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4469 bp)
Predicted protein sequence (1319 aa)
Source Human adult brain
Rouge ID mKIAA0790 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4469 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1319 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_518791 0 99.0 SAM and SH3 dom...
Pan troglodytes
CAD47811 0 100.0 putative adapte...
Homo sapiens
O94885 0 99.9 SAM and SH3 dom...
Homo sapiens
BAG72753 0 99.8 SAM and SH3 dom...
synthetic construct
AAH63279 0 99.9 SASH1 protein [...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR011511 630 685 PF07653 Variant SH3
IPR011510 707 769 PF07647 Sterile alpha motif homology 2
IPR011510 1246 1313 PF07647 Sterile alpha motif homology 2
HMMSmart IPR001452 629 686 SM00326 Src homology-3
IPR001660 702 769 SM00454 Sterile alpha motif SAM
IPR001660 1246 1313 SM00454 Sterile alpha motif SAM
ProfileScan IPR001660 705 769 PS50105 Sterile alpha motif SAM
IPR001660 1249 1313 PS50105 Sterile alpha motif SAM
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ATTAGTGCGGTTCTCTTTGAC
Primer_r AGACTGGAGATAGAGCATTCG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 6
Experimental conditions
Panel name GeneBridge 4
Primer_f ATTAGTGCGGTTCTCTTTGAC
Primer_r AGACTGGAGATAGAGCATTCG
PCR product length 110 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp