KIAA0991

Product ID	ORK06774
Accession No	AB023208
Description	septin 9
Clone name	hk06065
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3938 bp) Predicted protein sequence (630 aa)
Source	Human adult brain
Rouge ID	mKIAA0991 by Kazusa Mouse cDNA Project

Length: 3938 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1937 bp
Genome contig ID	gi51511734f_72783760
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- TTCCTGAAATAAATGTTTCAAATGCAGAAACCCAG
Flanking genome sequence (224513 - 224562)	----+--------+--------+--------+--------+----* AAGGCTCCTGAGTGAGAATGTTTTTTCTGCCCCTGAAGTGCAGTTCTTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	72883760	73008271	11	99.4	Perfect prediction

Length: 630 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAC42221	5.2e-166	99.1	OVARIAN/Breast ...	Homo sapiens
AAD39749	6.3e-166	99.6	MLL septin-like...	Homo sapiens
AAP36691	6.3e-166	99.6	MLL septin-like...	synthetic construct
BAG62031	7.9e-166	100.0	unnamed protein...	Homo sapiens
NP_001106965	8e-166	98.9	septin 9 isofor...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D63878	3.9e-23	46.5	KIAA0158
D50918	6.8e-20	44.4	KIAA0128
D86957	8.9e-20	41.2	KIAA0202

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000038	447	505	PD002565	Cell division/GTP binding protein
HMMPfam	IPR000038	339	618	PF00735	Cell division/GTP binding protein
ScanRegExp	IPR001998	267	274	PS00172	Xylose isomerase

Primer_f	CAGCGAGAAGGAGTGTATGAG
Primer_r	GCAAAAACATGGCAAGTCGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	CAGCGAGAAGGAGTGTATGAG
Primer_r	GCAAAAACATGGCAAGTCGGC
PCR product length	147 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles