KIAA0867

Product ID	ORK06012
Accession No	AB020674
Description	MLX interacting protein
Clone name	hk06783
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4339 bp) Predicted protein sequence (568 aa)
Source	Human adult brain
Rouge ID	mKIAA0867 by Kazusa Mouse cDNA Project

Length: 4339 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2606 bp
Genome contig ID	gi89161190f_121083783
PolyA signal sequence (None)	+--------+--------+----*----+---- CCAACCCTGGCAACATAACAAGACCCTGTCTCTAC
Flanking genome sequence (111137 - 111186)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAATTTAGCCGTGTGTAGCAGTGAGTGCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	121183783	121194918	9	100.0	Perfect prediction

Length: 568 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW98304	1.8e-161	100.0	MLX interacting...	Homo sapiens
Q9HAP2	2e-161	100.0	MLX-interacting...	Homo sapiens
AAG34121	5.2e-161	99.8	MondoA [Homo sa...	Homo sapiens
XP_509441	2.3e-160	99.5	MLX interacting...	Pan troglodytes
XP_001094210	3.9e-156	96.4	similar to mond...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001092	369	419	PF00010	Basic helix-loop-helix dimerisation region bHLH
HMMSmart	IPR001092	374	424	SM00353	Basic helix-loop-helix dimerisation region bHLH
ProfileScan	IPR001092	366	419	PS50888	Basic helix-loop-helix dimerisation region bHLH

Primer_f	CCAAGAACTCTCCTAAATCAG
Primer_r	AGCACCAAGAGAATGAGTTAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GATGAATCCAGCCAGACCAAG
Primer_r	GAAAGTGGGGGCAAGAATCAG
PCR product length	166 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles