KIAA0883

Product ID	ORK00671
Accession No	AB020690
Description	paraneoplastic Ma antigen 2
Clone name	hk07589
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4253 bp) Predicted protein sequence (373 aa)
HaloTag ORF Clone	FHC00671
Flexi ORF Clone	FXC00671
Source	Human adult brain
Rouge ID	mKIAA0883 by Kazusa Mouse cDNA Project

Length: 4253 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2981 bp
Genome contig ID	gi51511724r_26318113
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- ATATGCTAATAAAATCCTGAGTTTTTCTGATTCCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATATCGTGGTCTCTATAAAGTACTGCTTGAAGAAGGAGCTTTGTTACTGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	r	26418113	26422365	1	99.0	Perfect prediction

Length: 373 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9UL42	4.3e-144	100.0	Paraneoplastic ...	Homo sapiens
AAH36489	1.4e-143	99.7	Paraneoplastic ...	Homo sapiens
XP_528094	3.9e-143	99.2	similar to para...	Pan troglodytes
Q5R486	2.4e-141	98.1	Paraneoplastic ...	Pongo abelii
Q9GMU3	2.2e-140	97.3	Paraneoplastic ...	Macaca fascicularis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067521	1.8e-53	46.7	KIAA1934

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005162	213	288	PF03732	Retrotransposon gag protein

Primer_f	CATTCATTGGTGGGTTCTAAG
Primer_r	CTAACAGTGCCAGCGCCATTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CATTCATTGGTGGGTTCTAAG
Primer_r	CTAACAGTGCCAGCGCCATTG
PCR product length	142 bp
PCR conditions	95 °C15 sec62 °C60 sec35 cycles