KIAA0897

Product ID	ORK06447
Accession No	AB020704
Description	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Clone name	hk09524
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3605 bp) Predicted protein sequence (419 aa)
Source	Human adult brain
Rouge ID	mKIAA0897 by Kazusa Mouse cDNA Project

Length: 3605 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2344 bp
Genome contig ID	gi89161185f_201192658
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- ACGTACCAATAAACAACCTGGTTTTAAGACAATGT
Flanking genome sequence (121830 - 121879)	----+--------+--------+--------+--------+----* ACAAATGGCCTCCAGTCTTTTTTTTTTTTTTTTTTTTTTTTTTTAACTCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	201292658	201314486	12	99.3	Perfect prediction

Length: 419 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O75335	2.2e-177	100.0	Liprin-alpha-4;...	Homo sapiens
EAW91462	2.7e-177	100.0	protein tyrosin...	Homo sapiens
ABR09268	3.3e-177	100.0	liprin alpha4 [...	Homo sapiens
CAH72276	3.3e-177	100.0	protein tyrosin...	Homo sapiens
BAG58587	1.2e-176	99.5	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014554	1.4e-100	67.0	KIAA0654
AB033056	5e-16	31.5	KIAA1230

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001660	61	127	PF00536	Sterile alpha motif SAM
	IPR001660	176	240	PF00536	Sterile alpha motif SAM
	IPR011510	263	335	PF07647	Sterile alpha motif homology 2
HMMSmart	IPR001660	60	129	SM00454	Sterile alpha motif SAM
	IPR001660	175	242	SM00454	Sterile alpha motif SAM
	IPR001660	263	335	SM00454	Sterile alpha motif SAM
ProfileScan	IPR001660	63	129	PS50105	Sterile alpha motif SAM
	IPR001660	185	242	PS50105	Sterile alpha motif SAM
	IPR001660	266	335	PS50105	Sterile alpha motif SAM

Primer_f	AGGCTGTTGTCTTGGTGTATC
Primer_r	ACTGAGAAGGGACCTGATGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGGCTGTTGTCTTGGTGTATC
Primer_r	ACTGAGAAGGGACCTGATGAG
PCR product length	117 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles