KIAA1985

Product ID	ORK06821
Accession No	AB075865
Description	SH3 domain and tetratricopeptide repeats 2
Clone name	pf00647
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7327 bp) Predicted protein sequence (955 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA1985 by Kazusa Mouse cDNA Project

Length: 7327 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	3366 bp
Genome contig ID	gi51511721r_148261104
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- CATCTAATCTAAATAAAGAACAAGAAGGGCATTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACATTGTGGAAAACCCTGTAACATGTTTTCTCAGCTTTCAGGTATACTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	148361104	148422800	18	99.2	Perfect prediction

Length: 955 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI13880	99.9	SH3 domain and ...	Homo sapiens
EAW61795	99.8	hCG1979865, iso...	Homo sapiens
AAI14487	99.8	SH3TC2 protein ...	Homo sapiens
XP_001161962	99.4	SH3 domain and ...	Pan troglodytes
XP_001162001	99.4	SH3 domain and ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028966	0.00016	24.5	KIAA1043

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001440	503	536	PF00515	Tetratricopeptide TPR_1
HMMPfam	IPR001440	833	866	PF00515	Tetratricopeptide TPR_1
HMMSmart	IPR013026	195	228	SM00028	Tetratricopeptide region
	IPR013026	503	536	SM00028	Tetratricopeptide region
	IPR013026	711	744	SM00028	Tetratricopeptide region
	IPR013026	833	866	SM00028	Tetratricopeptide region

Primer_f	TTGAATCCATCCAGAATCCTC
Primer_r	TTAGGTCCATGAGCAGTTCCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-