Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00903 |
---|---|
Accession No | AB051511 |
Description | ethanolaminephosphotransferase 1 |
Clone name | pf00943 |
Vector information | |
cDNA sequence | DNA sequence (8082 bp) Predicted protein sequence (400 aa) |
HaloTag ORF Clone |
FHC00903
|
Flexi ORF Clone | FXC00903 |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA1724
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 6812 bp |
---|---|
Genome contig ID | gi89161199f_26322496 |
PolyA signal sequence (AATAAA,-34) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (149761 - 149810) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | f | 26422496 | 26472255 | 10 | 99.1 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000462 | 108 | 252 | PF01066 | CDP-alcohol phosphatidyltransferase |
ScanRegExp | IPR000462 | 121 | 143 | PS00379 | CDP-alcohol phosphatidyltransferase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 58 | FPTWLAPNLITFSGFLLVVFNFL | 80 | PRIMARY | 23 | 2 | 99 | VPDWVWIVVGILNFVAYTLDGVD | 121 | PRIMARY | 23 | 3 | 138 | FDHGLDSWSCVYFVVTVYSIFGR | 160 | SECONDARY | 23 | 4 | 163 | TGVSVFVLYLLLWVVLFSFILSH | 185 | PRIMARY | 23 | 5 | 195 | FLPWGYDISQVTISFVYIVTAVV | 217 | SECONDARY | 23 | 6 | 236 | FTAMIIGCALCVTLPMSLLNFF | 257 | PRIMARY | 22 | 7 | 269 | SVYEAMVPLFSPCLLFILSTAWI | 291 | PRIMARY | 23 | 8 | 305 | VFYFMVGTAFANSTCQLIVCQMS | 327 | SECONDARY | 23 | 9 | 341 | LFLVVLVVNLGVASYVESILLYT | 363 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | ATGACTTGTTTCCCTATGGTG |
---|---|
Primer_r | GCACTTTCAAGAATGGCAGAC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |