Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01068 |
---|---|
Accession No | AB002331 |
Description | death inducer-obliterator 1, transcript variant 3 |
Clone name | pf04993 |
Vector information | |
cDNA sequence | DNA sequence (7013 bp) Predicted protein sequence (1223 aa) |
HaloTag ORF Clone |
FHC01068
|
Flexi ORF Clone | FXC01068 |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA0333
by Kazusa Mouse cDNA Project
|
Note | We replaced hg00988, former representative clones for KIAA0333 with pf04993. (2001/10/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 3155 bp |
---|---|
Genome contig ID | gi51511747r_60889014 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 20 | r | 60989014 | 61039681 | 16 | 99.8 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001965 | 304 | 356 | PF00628 | Zinc finger |
IPR003618 | 704 | 818 | PF07500 | Transcription elongation factor S-II | |
IPR012921 | 1091 | 1197 | PF07744 | Spen paralogue and orthologue C-terminal | |
HMMSmart | IPR001965 | 304 | 354 | SM00249 | Zinc finger |
IPR003618 | 706 | 807 | SM00510 | Transcription elongation factor S-II | |
ProfileScan | IPR001965 | 302 | 356 | PS50016 | Zinc finger |
ScanRegExp | IPR001965 | 305 | 353 | PS01359 | Zinc finger |
RT-PCR |
---|
Primer_f | TCCATGCAAAGCTACTGTTAC |
---|---|
Primer_r | CTGCTCGAATGGAAAGGGCTC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TCCATGCAAAGCTACTGTTAC |
Primer_r | CTGCTCGAATGGAAAGGGCTC |
PCR product length | 202 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |