KIAA1744

Product ID	ORK07408
Accession No	AB051531
Description	zinc finger, CCHC domain containing 2
Clone name	pj01516
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4571 bp) Predicted protein sequence (855 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA1744 by Kazusa Mouse cDNA Project

Length: 4571 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2001 bp
Genome contig ID	gi51511735f_58257922
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TGAATTAACAGCAATAAAAAAATGAAAAACAGCTT
Flanking genome sequence (138876 - 138925)	----+--------+--------+--------+--------+----* AAGAATTGTGCCTCATTGTAAATTTTGTAAAAGTGGAGATAGGACATCAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	18	f	58357922	58396796	13	99.2	Perfect prediction

Length: 855 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI37436	100.0	Zinc finger, CC...	Homo sapiens
EAW63126	100.0	zinc finger, CC...	Homo sapiens
Q9C0B9	100.0	Zinc finger CCH...	Homo sapiens
CAL38351	99.8	hypothetical pr...	synthetic construct
CAD38618	99.8	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011151	1e-09	26.3	KIAA0579

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001878	808	817	PR00939	Zinc finger
FPrintScan	IPR001878	817	825	PR00939	Zinc finger
HMMPfam	IPR001878	808	825	PF00098	Zinc finger
HMMSmart	IPR001878	809	825	SM00343	Zinc finger
ProfileScan	IPR001878	810	825	PS50158	Zinc finger

Primer_f	ACTTTCTTTCAGGGGTGGGAG
Primer_r	ACAACTCAACTGCAGCTTAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-