KIAA2011

Product ID	ORK02061
Accession No	AB095931
Description	pleckstrin and Sec7 domain containing, transcript variant 1
Clone name	pj02017
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4183 bp) Predicted protein sequence (1091 aa)
HaloTag ORF Clone	FHC02061
Flexi ORF Clone	FXC02061
Source	Human brain (hippocampus)
Rouge ID	mKIAA2011 by Kazusa Mouse cDNA Project

Length: 4183 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	581 bp
Genome contig ID	gi89161187r_104052366
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- AGCCTCCACCCCCATTAAAACTGCTCTGGACTTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGGCTGGGCCTCCTCCTTCTCTTCTCACCATGCCTGGCATGTGGGCAGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	104152366	104168891	17	100.0	Perfect prediction

Length: 1091 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
A5PKW4	100.0	PH and SEC7 dom...	Homo sapiens
AAI42690	99.9	PSD protein [Ho...	Homo sapiens
XP_543989	94.4	similar to plec...	Canis lupus fam...
EDL41988	91.8	pleckstrin and ...	Mus musculus
Q5DTT2	91.8	PH and SEC7 dom...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023159	1.5e-42	59.0	KIAA0942
AB029033	0.00079	28.5	KIAA1110

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001605	848	869	PR00683	Spectrin/pleckstrin-like
	IPR001605	891	908	PR00683	Spectrin/pleckstrin-like
	IPR001605	911	929	PR00683	Spectrin/pleckstrin-like
HMMPfam	IPR000904	588	775	PF01369	SEC7-like
HMMPfam	IPR001849	824	936	PF00169	Pleckstrin-like
HMMSmart	IPR000904	586	775	SM00222	SEC7-like
HMMSmart	IPR001849	824	938	SM00233	Pleckstrin-like
ProfileScan	IPR000904	608	773	PS50190	SEC7-like
ProfileScan	IPR001849	823	936	PS50003	Pleckstrin-like

Primer_f	TCATGCTGCTCAACACGGATC
Primer_r	TCTCAGCTCCTCCTCGTCTAT
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-