KIAA1518

Product ID	ORK05563
Accession No	AB040951
Description	KN motif and ankyrin repeat domains 2, transcript variant 2
Clone name	sh00483
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5156 bp) Predicted protein sequence (876 aa)
HaloTag ORF Clone	FHC05563
Flexi ORF Clone	FXC05563
Source
Rouge ID	mKIAA1518 by Kazusa Mouse cDNA Project
Note	We replaced fh12339, former representative clones for KIAA1518 with sh00483. (2001/2/22)

Length: 5156 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2287 bp
Genome contig ID	gi42406306r_11035947
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GGTAAACAAATTTAATAAAGCTACCAATAATGTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGATTCTGTGTCTTTTCTTTTTTCGCTGTGCTCCCTTTTAAGCTTTAAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	r	11135947	11167485	13	98.8	Perfect prediction

Length: 876 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10083	100.0	ankyrin repeat ...	synthetic construct
Q63ZY3	99.9	KN motif and an...	Homo sapiens
XP_001106785	96.7	dedicator of cy...	Macaca mulatta
AAT57879	99.0	SRC-1 interacti...	Homo sapiens
EAW84175	98.9	ankyrin repeat ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D79994	2.7e-30	44.6	KIAA0172

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	692	704	PR01415	Ankyrin
FPrintScan	IPR002110	704	716	PR01415	Ankyrin
HMMPfam	IPR002110	691	724	PF00023	Ankyrin
	IPR002110	763	795	PF00023	Ankyrin
	IPR002110	796	829	PF00023	Ankyrin
	IPR002110	830	850	PF00023	Ankyrin
HMMSmart	IPR002110	691	721	SM00248	Ankyrin
	IPR002110	725	758	SM00248	Ankyrin
	IPR002110	763	792	SM00248	Ankyrin
	IPR002110	796	826	SM00248	Ankyrin
	IPR002110	830	858	SM00248	Ankyrin
ProfileScan	IPR002110	685	853	PS50297	Ankyrin
	IPR002110	691	716	PS50088	Ankyrin
	IPR002110	763	795	PS50088	Ankyrin