HUGE |
Gene/Protein Characteristic Table for KIAA0013 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04152 |
---|---|
Accession No. : | D87717 |
Description : | Rho GTPase-activating protein 11A precursor. |
HUGO Gene Name : | Rho GTPase activating protein 11A (ARHGAP11A) |
Clone Name : | ha00450s1 [Vector Info] |
Flexi ORF Clone : | pF1KA0013
![]() |
Source : | Myeloblast cell line (KG-1) |
Note : | We replaced ha00450, former representative clones for KIAA0013 with ha00450s1. (2008/8/27) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5616 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 1822 bp Genome contig ID gi51511731f_28605598 PolyA signal sequence
(AATGAA,-29) +----*----+----*----+----*----+----
ATCAATAATGAAACATGTCTGTTTTAAAAACTACCFlanking genome sequence
(2113564 - 2113613) ----+----*----+----*----+----*----+----*----+----*
ACATGTGACTCCTATTTTTGTTAGCTGAAAGCTGCTATACGGAGTATTAC
Features of the protein sequence |
Description | |
---|---|---|
Length: 1086 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 15 |
: Stanford G3 | |
: TAGGTTGTAGAGGAAGGAAT | |
: ATGCTGTAAGTCTGGTTGCT | |
: 141 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |