HUGE

Gene/Protein Characteristic Table for KIAA0020

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00367
Accession No. :	D13645
Description :
HUGO Gene Name :
Clone Name :	ha00602 [Vector Info]
Flexi ORF Clone :	pF1KSDA0020
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 2112 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 167 bp

Genome contig ID gi89161216r_2694178
PolyA signal sequence
(TATAAA,-23)
+----*----+----*----+----*----+----
CGAATCTATTTATATAAATTGTTTTTTTAAATGGT
Flanking genome sequence
(99986 - 99937)
----+----*----+----*----+----*----+----*----+----*
CTTTTTTAAAAATCTCAGCTGTCTCCTCTGTTACACTGAGTAGTAAGCAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 r 2794164 2828505 17 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 647 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_533539	0	91.6	similar to D19B...	Canis lupus fam...
BAC34427	0	89.6	unnamed protein...	Mus musculus
EDL41650	0	89.6	DNA segment, Ch...	Mus musculus
XP_215276	9.5e-215	88.4	similar to D19B...	Rattus norvegicus
XP_001066994	1e-214	88.4	similar to D19B...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D43951	2.1e-08	21.1	KIAA0099

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR012959 432 579 PF08144 CPL

HMMSmart IPR001313 164 199 SM00025 Pumilio/Puf RNA-binding

IPR001313 200 235 SM00025 Pumilio/Puf RNA-binding

IPR001313 236 272 SM00025 Pumilio/Puf RNA-binding

IPR001313 349 384 SM00025 Pumilio/Puf RNA-binding

IPR001313 385 421 SM00025 Pumilio/Puf RNA-binding

IPR001313 423 459 SM00025 Pumilio/Puf RNA-binding

ProfileScan IPR001313 136 509 PS50303 Pumilio/Puf RNA-binding

IPR001313 163 199 PS50302 Pumilio/Puf RNA-binding

IPR001313 200 235 PS50302 Pumilio/Puf RNA-binding

IPR001313 349 384 PS50302 Pumilio/Puf RNA-binding

IPR001313 423 459 PS50302 Pumilio/Puf RNA-binding

IPR001313 492 530 PS50302 Pumilio/Puf RNA-binding

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012959	432	579	PF08144	CPL
HMMSmart	IPR001313	164	199	SM00025	Pumilio/Puf RNA-binding
IPR001313	200	235	SM00025	Pumilio/Puf RNA-binding
IPR001313	236	272	SM00025	Pumilio/Puf RNA-binding
IPR001313	349	384	SM00025	Pumilio/Puf RNA-binding
IPR001313	385	421	SM00025	Pumilio/Puf RNA-binding
IPR001313	423	459	SM00025	Pumilio/Puf RNA-binding
ProfileScan	IPR001313	136	509	PS50303	Pumilio/Puf RNA-binding
IPR001313	163	199	PS50302	Pumilio/Puf RNA-binding
IPR001313	200	235	PS50302	Pumilio/Puf RNA-binding
IPR001313	349	384	PS50302	Pumilio/Puf RNA-binding
IPR001313	423	459	PS50302	Pumilio/Puf RNA-binding
IPR001313	492	530	PS50302	Pumilio/Puf RNA-binding

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: AAAGCACCAGCAAAGGAATAG
Primer_r	: TGGACCCTACCCCTTCTTTTC
PCR product length	: 134 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	167 bp
Genome contig ID	gi89161216r_2694178
PolyA signal sequence (TATAAA,-23)	+--------+--------+----*----+---- CGAATCTATTTATATAAATTGTTTTTTTAAATGGT
Flanking genome sequence (99986 - 99937)	----+--------+--------+--------+--------+----* CTTTTTTAAAAATCTCAGCTGTCTCCTCTGTTACACTGAGTAGTAAGCAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	r	2794164	2828505	17	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0020

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information