HUGE

Gene/Protein Characteristic Table for KIAA0099

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression

Product ID :	ORK01054
Accession No. :	D43951
Description :	Pumilio homolog 1.
HUGO Gene Name :	pumilio homolog 1 (Drosophila) (PUM1)
Clone Name :	hk05583 [Vector Info]
Flexi ORF Clone :	pF1KA0099
Source :	Human adult brain
Note :	We replaced ha03551, former representative clones for KIAA0099 with hk05583. (2001/10/06)

Features of the cloned DNA sequence	Description

Length: 3936 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 367 bp

Genome contig ID gi89161185r_31078294
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TCAGGGTGGTTGGTTTAACAAAAAAAAAAAGCTTT
Flanking genome sequence
(99984 - 99935)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAGAAAAAAAGGAAAAGGTTTTTAGCTCATTTGCCTGGCCGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 31178278 31311118 22 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1175 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11135	100.0	pumilio homolog...	synthetic construct
XP_001096958	99.9	similar to Pumi...	Macaca mulatta
XP_865286	99.4	similar to pumi...	Canis lupus fam...
XP_001157494	94.7	pumilio 1 isofo...	Pan troglodytes
XP_001140088	79.0	pumilio homolog...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D87078	6.8e-98	76.6	KIAA0235
D13645	0.00022	21.1	KIAA0020

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001313 835 869 PF00806 Pumilio/Puf RNA-binding

IPR001313 871 905 PF00806 Pumilio/Puf RNA-binding

IPR001313 907 942 PF00806 Pumilio/Puf RNA-binding

IPR001313 945 979 PF00806 Pumilio/Puf RNA-binding

IPR001313 981 1015 PF00806 Pumilio/Puf RNA-binding

IPR001313 1017 1051 PF00806 Pumilio/Puf RNA-binding

IPR001313 1053 1088 PF00806 Pumilio/Puf RNA-binding

IPR001313 1096 1130 PF00806 Pumilio/Puf RNA-binding

HMMSmart IPR001313 835 870 SM00025 Pumilio/Puf RNA-binding

IPR001313 871 906 SM00025 Pumilio/Puf RNA-binding

IPR001313 907 941 SM00025 Pumilio/Puf RNA-binding

IPR001313 945 980 SM00025 Pumilio/Puf RNA-binding

IPR001313 981 1016 SM00025 Pumilio/Puf RNA-binding

IPR001313 1017 1052 SM00025 Pumilio/Puf RNA-binding

IPR001313 1053 1088 SM00025 Pumilio/Puf RNA-binding

IPR001313 1096 1131 SM00025 Pumilio/Puf RNA-binding

ProfileScan IPR001313 815 1157 PS50303 Pumilio/Puf RNA-binding

IPR001313 835 870 PS50302 Pumilio/Puf RNA-binding

IPR001313 871 906 PS50302 Pumilio/Puf RNA-binding

IPR001313 907 944 PS50302 Pumilio/Puf RNA-binding

IPR001313 945 980 PS50302 Pumilio/Puf RNA-binding

IPR001313 981 1016 PS50302 Pumilio/Puf RNA-binding

IPR001313 1017 1052 PS50302 Pumilio/Puf RNA-binding

IPR001313 1053 1088 PS50302 Pumilio/Puf RNA-binding

IPR001313 1092 1131 PS50302 Pumilio/Puf RNA-binding

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001313	835	869	PF00806	Pumilio/Puf RNA-binding
IPR001313	871	905	PF00806	Pumilio/Puf RNA-binding
IPR001313	907	942	PF00806	Pumilio/Puf RNA-binding
IPR001313	945	979	PF00806	Pumilio/Puf RNA-binding
IPR001313	981	1015	PF00806	Pumilio/Puf RNA-binding
IPR001313	1017	1051	PF00806	Pumilio/Puf RNA-binding
IPR001313	1053	1088	PF00806	Pumilio/Puf RNA-binding
IPR001313	1096	1130	PF00806	Pumilio/Puf RNA-binding
HMMSmart	IPR001313	835	870	SM00025	Pumilio/Puf RNA-binding
IPR001313	871	906	SM00025	Pumilio/Puf RNA-binding
IPR001313	907	941	SM00025	Pumilio/Puf RNA-binding
IPR001313	945	980	SM00025	Pumilio/Puf RNA-binding
IPR001313	981	1016	SM00025	Pumilio/Puf RNA-binding
IPR001313	1017	1052	SM00025	Pumilio/Puf RNA-binding
IPR001313	1053	1088	SM00025	Pumilio/Puf RNA-binding
IPR001313	1096	1131	SM00025	Pumilio/Puf RNA-binding
ProfileScan	IPR001313	815	1157	PS50303	Pumilio/Puf RNA-binding
IPR001313	835	870	PS50302	Pumilio/Puf RNA-binding
IPR001313	871	906	PS50302	Pumilio/Puf RNA-binding
IPR001313	907	944	PS50302	Pumilio/Puf RNA-binding
IPR001313	945	980	PS50302	Pumilio/Puf RNA-binding
IPR001313	981	1016	PS50302	Pumilio/Puf RNA-binding
IPR001313	1017	1052	PS50302	Pumilio/Puf RNA-binding
IPR001313	1053	1088	PS50302	Pumilio/Puf RNA-binding
IPR001313	1092	1131	PS50302	Pumilio/Puf RNA-binding

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	367 bp
Genome contig ID	gi89161185r_31078294
PolyA signal sequence (None)	+--------+--------+----*----+---- TCAGGGTGGTTGGTTTAACAAAAAAAAAAAGCTTT
Flanking genome sequence (99984 - 99935)	----+--------+--------+--------+--------+----* AAAAAAAAAAGAAAAAAAGGAAAAGGTTTTTAGCTCATTTGCCTGGCCGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	31178278	31311118	22	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0099

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile