HUGE |
Gene/Protein Characteristic Table for KIAA0099 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | |
Product ID : | ORK01054 |
---|---|
Accession No. : | D43951 |
Description : | Pumilio homolog 1. |
HUGO Gene Name : | pumilio homolog 1 (Drosophila) (PUM1) |
Clone Name : | hk05583 [Vector Info] |
Flexi ORF Clone : | pF1KA0099
![]() |
Source : | Human adult brain |
Note : | We replaced ha03551, former representative clones for KIAA0099 with hk05583. (2001/10/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3936 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 367 bp Genome contig ID gi89161185r_31078294 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TCAGGGTGGTTGGTTTAACAAAAAAAAAAAGCTTTFlanking genome sequence
(99984 - 99935) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAGAAAAAAAGGAAAAGGTTTTTAGCTCATTTGCCTGGCCGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 r 31178278 31311118 22 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1175 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |