HUGE |
Gene/Protein Characteristic Table for KIAA0235 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00471 |
---|---|
Accession No. : | D87078 |
Description : | Pumilio homolog 2. |
HUGO Gene Name : | pumilio homolog 2 (Drosophila) (PUM2) |
Clone Name : | ha04677s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0235
![]() |
Source : | Myeloblast cell line (KG-1) |
Note : | We replaced ha04677, former representative clones for KIAA0235 with ha04677s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6040 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2845 bp Genome contig ID gi89161199r_20211982 PolyA signal sequence
(AATGAA,-33) +----*----+----*----+----*----+----
AAAATGAAAAATGTGTGAATAACATTGTATGAAATFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAACCTGGTCTTGTGTTTTTCTCTAGATAAAATACCCCTCTGTACCTCAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 r 20311982 20390602 20 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1064 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001313 | 726 | 760 | PF00806 | Pumilio/Puf RNA-binding |
IPR001313 | 762 | 796 | PF00806 | Pumilio/Puf RNA-binding | |
IPR001313 | 798 | 832 | PF00806 | Pumilio/Puf RNA-binding | |
IPR001313 | 834 | 868 | PF00806 | Pumilio/Puf RNA-binding | |
IPR001313 | 870 | 904 | PF00806 | Pumilio/Puf RNA-binding | |
IPR001313 | 906 | 940 | PF00806 | Pumilio/Puf RNA-binding | |
IPR001313 | 942 | 976 | PF00806 | Pumilio/Puf RNA-binding | |
IPR001313 | 985 | 1019 | PF00806 | Pumilio/Puf RNA-binding | |
HMMSmart | IPR001313 | 726 | 761 | SM00025 | Pumilio/Puf RNA-binding |
IPR001313 | 762 | 797 | SM00025 | Pumilio/Puf RNA-binding | |
IPR001313 | 798 | 833 | SM00025 | Pumilio/Puf RNA-binding | |
IPR001313 | 834 | 869 | SM00025 | Pumilio/Puf RNA-binding | |
IPR001313 | 870 | 905 | SM00025 | Pumilio/Puf RNA-binding | |
IPR001313 | 906 | 941 | SM00025 | Pumilio/Puf RNA-binding | |
IPR001313 | 942 | 977 | SM00025 | Pumilio/Puf RNA-binding | |
IPR001313 | 985 | 1020 | SM00025 | Pumilio/Puf RNA-binding | |
ProfileScan | IPR001313 | 706 | 1046 | PS50303 | Pumilio/Puf RNA-binding |
IPR001313 | 726 | 761 | PS50302 | Pumilio/Puf RNA-binding | |
IPR001313 | 762 | 797 | PS50302 | Pumilio/Puf RNA-binding | |
IPR001313 | 798 | 833 | PS50302 | Pumilio/Puf RNA-binding | |
IPR001313 | 834 | 869 | PS50302 | Pumilio/Puf RNA-binding | |
IPR001313 | 870 | 905 | PS50302 | Pumilio/Puf RNA-binding | |
IPR001313 | 906 | 941 | PS50302 | Pumilio/Puf RNA-binding | |
IPR001313 | 942 | 977 | PS50302 | Pumilio/Puf RNA-binding | |
IPR001313 | 978 | 1020 | PS50302 | Pumilio/Puf RNA-binding |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 2 |
: Genebridge 4 | |
: TTCATCCTTGCCCTCTGTTGG | |
: TATTGGGAAGATTGGGTTGTC | |
: 152 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |