HUGE |
Gene/Protein Characteristic Table for KIAA0021 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | |
---|---|
Accession No. : | D14665 |
Description : | ADAM 9 precursor. |
HUGO Gene Name : | ADAM metallopeptidase domain 9 (meltrin gamma) (ADAM9) |
Clone Name : | ha00117 [Vector Info] |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3541 bp
![]() |
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
cloned DNA seq. | Warning for N-terminal truncation: YES | YES | Warning for coding interruption: YES | NO | |
Length of 3'UTR 1299 bp Genome contig ID gi51511724f_38892811 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
TACAACATTTACAATAAATAAAATACTTGAAATTCFlanking genome sequence
(188866 - 188915) ----+----*----+----*----+----*----+----*----+----*
TCTTTTGTGTCTCCTAGTAGCTTCCTACTCAACTATTTATAATCTCATTA
Chr f/r start end exon identity class ContigView(URL based/DAS) 8 f 38992808 39081675 18 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 703 aa
This protein sequence is predicted from the revised DNA sequence
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 8 |
: Stanford G3 | |
: AGGCTGGAGAAAGAAGGAAG | |
: CCATACCATATCTGCCATAG | |
: 123 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |