HUGE

Gene/Protein Characteristic Table for KIAA0021

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	D14665
Description :	ADAM 9 precursor.
HUGO Gene Name :	ADAM metallopeptidase domain 9 (meltrin gamma) (ADAM9)
Clone Name :	ha00117 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 3541 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 1299 bp

Genome contig ID gi51511724f_38892811
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TACAACATTTACAATAAATAAAATACTTGAAATTC
Flanking genome sequence
(188866 - 188915)
----+----*----+----*----+----*----+----*----+----*
TCTTTTGTGTCTCCTAGTAGCTTCCTACTCAACTATTTATAATCTCATTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 f 38992808 39081675 18 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 703 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_519719	99.9	ADAM metallopep...	Pan troglodytes
Q13443	99.9	ADAM 9; A disin...	Homo sapiens
XP_001092710	98.3	ADAM metallopep...	Macaca mulatta
XP_532798	93.9	similar to ADAM...	Canis lupus fam...
XP_001925699	92.3	cellular disint...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037767	1.6e-06	25.8	KIAA1346
AB095949	5.5e-06	23.1	KIAA2029
AB037733	3.6e-05	25.0	KIAA1312
AB002364	0.00075	22.9	KIAA0366
AB014588	0.00084	23.1	KIAA0688

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001762 339 377 PD000664 Blood coagulation inhibitor

HMMPfam IPR002870 1 47 PF01562 Peptidase M12B

IPR001590 96 290 PF01421 Peptidase M12B

IPR001762 307 383 PF00200 Blood coagulation inhibitor

IPR006586 385 501 PF08516 ADAM

IPR013111 528 557 PF07974 EGF

HMMSmart IPR001762 307 383 SM00050 Blood coagulation inhibitor

IPR006586 384 521 SM00608 ADAM

ProfileScan IPR001590 96 290 PS50215 Peptidase M12B

IPR001762 298 385 PS50214 Blood coagulation inhibitor

IPR000742 524 558 PS50026 EGF-like

ScanRegExp IPR006025 228 237 PS00142 Peptidase M

IPR001762 339 358 PS00427 Blood coagulation inhibitor

IPR013032 546 557 PS01186 EGF-like region

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001762	339	377	PD000664	Blood coagulation inhibitor
HMMPfam	IPR002870	1	47	PF01562	Peptidase M12B
IPR001590	96	290	PF01421	Peptidase M12B
IPR001762	307	383	PF00200	Blood coagulation inhibitor
IPR006586	385	501	PF08516	ADAM
IPR013111	528	557	PF07974	EGF
HMMSmart	IPR001762	307	383	SM00050	Blood coagulation inhibitor
IPR006586	384	521	SM00608	ADAM
ProfileScan	IPR001590	96	290	PS50215	Peptidase M12B
IPR001762	298	385	PS50214	Blood coagulation inhibitor
IPR000742	524	558	PS50026	EGF-like
ScanRegExp	IPR006025	228	237	PS00142	Peptidase M
IPR001762	339	358	PS00427	Blood coagulation inhibitor
IPR013032	546	557	PS01186	EGF-like region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 581 DGLLVFFFLIVPLIVCAIFIFI 602 PRIMARY 22

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	581	DGLLVFFFLIVPLIVCAIFIFI	602	PRIMARY	22

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: Stanford G3
Primer_f	: AGGCTGGAGAAAGAAGGAAG
Primer_r	: CCATACCATATCTGCCATAG
PCR product length	: 123 bp
PCR conditions	: 95 °C15 sec60 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	1299 bp
Genome contig ID	gi51511724f_38892811
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TACAACATTTACAATAAATAAAATACTTGAAATTC
Flanking genome sequence (188866 - 188915)	----+--------+--------+--------+--------+----* TCTTTTGTGTCTCCTAGTAGCTTCCTACTCAACTATTTATAATCTCATTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	f	38992808	39081675	18	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA0021

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information