HUGE

Gene/Protein Characteristic Table for KIAA0688

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00605
Accession No. :	AB014588
Description :	ADAMTS-4 precursor.
HUGO Gene Name :	ADAM metallopeptidase with thrombospondin type 1 motif, 4 (ADAMTS4)
Clone Name :	hk03410 [Vector Info]
Flexi ORF Clone :	pF1KSDA0688
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4301 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1387 bp

Genome contig ID gi89161185r_159326262
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
AGGATTAAATAATGTAAATAAAGAACTAGCATAAC
Flanking genome sequence
(99905 - 99856)
----+----*----+----*----+----*----+----*----+----*
ACTCAGCATCTAGTAAGTGCTCAACAAATAGCAGCTGCTGTTACTTACTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 159426167 159435441 9 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 849 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09812	100.0	ADAM metallopep...	synthetic construct
O75173	99.9	A disintegrin a...	Homo sapiens
CAH72146	99.8	ADAM metallopep...	Homo sapiens
BAF84262	99.8	unnamed protein...	Homo sapiens
AAQ89245	99.8	ADAMTS4 [Homo s...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037767	4.7e-131	50.1	KIAA1346
AB037733	2.4e-95	46.0	KIAA1312
AB002364	8.3e-53	31.8	KIAA0366
AB095949	3.2e-37	35.6	KIAA2029
AB011177	2.3e-22	33.9	KIAA0605

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR013273 541 559 PR01857 Peptidase M12B

IPR013273 658 677 PR01857 Peptidase M12B

IPR013273 678 697 PR01857 Peptidase M12B

HMMPfam IPR002870 48 154 PF01562 Peptidase M12B

IPR001590 230 440 PF01421 Peptidase M12B

IPR000884 536 586 PF00090 Thrombospondin

IPR010294 698 815 PF05986 ADAM-TS Spacer 1

HMMSmart IPR006586 453 521 SM00608 ADAM

IPR000884 535 587 SM00209 Thrombospondin

ProfileScan IPR001590 230 440 PS50215 Peptidase M12B

IPR000884 532 587 PS50092 Thrombospondin

ScanRegExp IPR006025 370 379 PS00142 Peptidase M

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR013273	541	559	PR01857	Peptidase M12B
IPR013273	658	677	PR01857	Peptidase M12B
IPR013273	678	697	PR01857	Peptidase M12B
HMMPfam	IPR002870	48	154	PF01562	Peptidase M12B
IPR001590	230	440	PF01421	Peptidase M12B
IPR000884	536	586	PF00090	Thrombospondin
IPR010294	698	815	PF05986	ADAM-TS Spacer 1
HMMSmart	IPR006586	453	521	SM00608	ADAM
IPR000884	535	587	SM00209	Thrombospondin
ProfileScan	IPR001590	230	440	PS50215	Peptidase M12B
IPR000884	532	587	PS50092	Thrombospondin
ScanRegExp	IPR006025	370	379	PS00142	Peptidase M

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 31 GAQPCLLLPIVPLSWLVWLLLLL 53 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	31	GAQPCLLLPIVPLSWLVWLLLLL	53	PRIMARY	23

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACCTGTTCTGCTTTCCTCTTC

Primer_r
: AAGATAATCCCTCACTCCCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACCTGTTCTGCTTTCCTCTTC
Primer_r	: AAGATAATCCCTCACTCCCTG
PCR product length	: 91 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1387 bp
Genome contig ID	gi89161185r_159326262
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AGGATTAAATAATGTAAATAAAGAACTAGCATAAC
Flanking genome sequence (99905 - 99856)	----+--------+--------+--------+--------+----* ACTCAGCATCTAGTAAGTGCTCAACAAATAGCAGCTGCTGTTACTTACTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	159426167	159435441	9	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0688

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information