HUGE |
Gene/Protein Characteristic Table for KIAA0605 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01984 |
---|---|
Accession No. : | AB011177 |
Description : | ADAMTS-like protein 2 precursor. |
HUGO Gene Name : | ADAMTS-like 2 (ADAMTSL2) |
Clone Name : | hg03238a [Vector Info] |
Flexi ORF Clone : | pF1KA0605 |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4067 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 654 bp Genome contig ID gi89161216f_135287440 PolyA signal sequence
(AATAAA,-26) +----*----+----*----+----*----+----
ATCTACGTTAATAAAGTGGTCCTATTTATGGCGGCFlanking genome sequence
(143023 - 143072) ----+----*----+----*----+----*----+----*----+----*
ATCATGGGGTCTCAGTTGCCTCTGGCTGGAGAAGTGGGTGGCCTGGGGAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 9 f 135387107 135430461 19 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1031 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: CTAAGAGACGTGGCACTGAGC | |
: ACAAACACAGGATCCACGCAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 9 |
: GeneBridge 4 | |
: CTAAGAGACGTGGCACTGAGC | |
: ACAAACACAGGATCCACGCAG | |
: 165 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |