HUGE

Gene/Protein Characteristic Table for KIAA1233

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04047
Accession No. :	AB033059
Description :	ADAMTS-like protein 3 precursor.
HUGO Gene Name :	ADAMTS-like 3 (ADAMTSL3)
Clone Name :	fh08611 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5107 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2033 bp

Genome contig ID gi51511731f_82283675
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ATAAATTTACTTTGATTATTCAGTGGCATCCTTAT
Flanking genome sequence
(215922 - 215971)
----+----*----+----*----+----*----+----*----+----*
AAATGTAGGCAGCTTATGTGTGTTATTTTTTGGTAGCCTTCGGTCTTGTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 f 82383675 82499595 14 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1023 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_997400	100.0	ADAMTS-like 3 p...	Homo sapiens
P82987	100.0	ADAMTS-like pro...	Homo sapiens
EAW62418	100.0	ADAMTS-like 3 [...	Homo sapiens
AAI28390	99.8	ADAMTS-like 3 [...	Homo sapiens
XP_523141	98.9	ADAMTS-like 3 [...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011177	1.2e-18	32.4	KIAA0605
AB095949	3.1e-09	36.6	KIAA2029
AB002364	3.7e-08	32.8	KIAA0366
AB018305	4.5e-08	26.3	KIAA0762
AB037733	2e-07	23.1	KIAA1312

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000884 42 91 PF00090 Thrombospondin

IPR000884 98 133 PF00090 Thrombospondin

IPR000884 158 185 PF00090 Thrombospondin

IPR013151 259 316 PF00047 Immunoglobulin

IPR013151 540 597 PF00047 Immunoglobulin

IPR013098 631 716 PF07679 Immunoglobulin I-set

IPR000884 760 815 PF00090 Thrombospondin

IPR000884 821 843 PF00090 Thrombospondin

IPR000884 933 987 PF00090 Thrombospondin

IPR010909 990 1022 PF08686 PLAC

HMMSmart IPR000884 38 92 SM00209 Thrombospondin

IPR000884 94 152 SM00209 Thrombospondin

IPR000884 154 213 SM00209 Thrombospondin

IPR003599 251 328 SM00409 Immunoglobulin subtype

IPR003598 257 321 SM00408 Immunoglobulin subtype 2

IPR003599 532 622 SM00409 Immunoglobulin subtype

IPR003598 538 602 SM00408 Immunoglobulin subtype 2

IPR003599 638 717 SM00409 Immunoglobulin subtype

IPR003598 644 706 SM00408 Immunoglobulin subtype 2

IPR000884 759 816 SM00209 Thrombospondin

IPR000884 818 877 SM00209 Thrombospondin

IPR000884 932 976 SM00209 Thrombospondin

ProfileScan IPR000884 35 92 PS50092 Thrombospondin

IPR000884 95 150 PS50092 Thrombospondin

IPR000884 151 213 PS50092 Thrombospondin

IPR007110 228 324 PS50835 Immunoglobulin-like

IPR007110 517 611 PS50835 Immunoglobulin-like

IPR007110 628 710 PS50835 Immunoglobulin-like

IPR000884 756 814 PS50092 Thrombospondin

IPR000884 815 877 PS50092 Thrombospondin

IPR000884 929 976 PS50092 Thrombospondin

IPR010909 987 1023 PS50900 PLAC

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000884	42	91	PF00090	Thrombospondin
IPR000884	98	133	PF00090	Thrombospondin
IPR000884	158	185	PF00090	Thrombospondin
IPR013151	259	316	PF00047	Immunoglobulin
IPR013151	540	597	PF00047	Immunoglobulin
IPR013098	631	716	PF07679	Immunoglobulin I-set
IPR000884	760	815	PF00090	Thrombospondin
IPR000884	821	843	PF00090	Thrombospondin
IPR000884	933	987	PF00090	Thrombospondin
IPR010909	990	1022	PF08686	PLAC
HMMSmart	IPR000884	38	92	SM00209	Thrombospondin
IPR000884	94	152	SM00209	Thrombospondin
IPR000884	154	213	SM00209	Thrombospondin
IPR003599	251	328	SM00409	Immunoglobulin subtype
IPR003598	257	321	SM00408	Immunoglobulin subtype 2
IPR003599	532	622	SM00409	Immunoglobulin subtype
IPR003598	538	602	SM00408	Immunoglobulin subtype 2
IPR003599	638	717	SM00409	Immunoglobulin subtype
IPR003598	644	706	SM00408	Immunoglobulin subtype 2
IPR000884	759	816	SM00209	Thrombospondin
IPR000884	818	877	SM00209	Thrombospondin
IPR000884	932	976	SM00209	Thrombospondin
ProfileScan	IPR000884	35	92	PS50092	Thrombospondin
IPR000884	95	150	PS50092	Thrombospondin
IPR000884	151	213	PS50092	Thrombospondin
IPR007110	228	324	PS50835	Immunoglobulin-like
IPR007110	517	611	PS50835	Immunoglobulin-like
IPR007110	628	710	PS50835	Immunoglobulin-like
IPR000884	756	814	PS50092	Thrombospondin
IPR000884	815	877	PS50092	Thrombospondin
IPR000884	929	976	PS50092	Thrombospondin
IPR010909	987	1023	PS50900	PLAC

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGGCTTTGGATGTGTCTGTGG

Primer_r
: GTGCTCAACCCAGTGTCAGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2033 bp
Genome contig ID	gi51511731f_82283675
PolyA signal sequence (None)	+--------+--------+----*----+---- ATAAATTTACTTTGATTATTCAGTGGCATCCTTAT
Flanking genome sequence (215922 - 215971)	----+--------+--------+--------+--------+----* AAATGTAGGCAGCTTATGTGTGTTATTTTTTGGTAGCCTTCGGTCTTGTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	f	82383675	82499595	14	99.4	Perfect prediction

Primer_f	: TGGCTTTGGATGTGTCTGTGG
Primer_r	: GTGCTCAACCCAGTGTCAGTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1233

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information