HUGE

Gene/Protein Characteristic Table for KIAA0762

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06967
Accession No. :	AB018305
Description :	Spondin-1 precursor.
HUGO Gene Name :	spondin 1, extracellular matrix protein (SPON1)
Clone Name :	hk04668s1 [Vector Info]
Source :	Human adult brain
Note :	We replaced hk04668, former representative clones for KIAA0762 with hk04668s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4301 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2124 bp

Genome contig ID gi51511727f_13860979
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
CATTTTGGAAATAAAGATTTTTTACTACAAAAATG
Flanking genome sequence
(384956 - 385005)
----+----*----+----*----+----*----+----*----+----*
AAATTTGTTTGGACTTCCACTTGAGACAGTAAAGAGAGTATTAGACACCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 f 13960979 14245933 15 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 724 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9HCB6	100.0	Spondin-1; F-sp...	Homo sapiens
XP_508295	99.7	spondin 1, extr...	Pan troglodytes
BAB18461	99.7	VSGP/F-spondin ...	Homo sapiens
XP_001093336	99.6	spondin 1, extr...	Macaca mulatta
BAC11217	99.6	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037733	5.1e-15	26.4	KIAA1312
AB011177	8.2e-14	28.2	KIAA0605
AB011122	2.9e-13	31.7	KIAA0550
AB023177	5.1e-11	26.6	KIAA0960
AB002364	3.7e-09	29.5	KIAA0366

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002861 1 90 PF02014 Reeler region

IPR009465 91 332 PF06468 Spondin

IPR000884 363 411 PF00090 Thrombospondin

IPR000884 422 471 PF00090 Thrombospondin

IPR000884 479 527 PF00090 Thrombospondin

IPR000884 535 582 PF00090 Thrombospondin

IPR000884 589 637 PF00090 Thrombospondin

IPR000884 675 724 PF00090 Thrombospondin

HMMSmart IPR000884 362 412 SM00209 Thrombospondin

IPR000884 421 472 SM00209 Thrombospondin

IPR000884 478 528 SM00209 Thrombospondin

IPR000884 534 583 SM00209 Thrombospondin

IPR000884 588 638 SM00209 Thrombospondin

IPR000884 674 723 SM00209 Thrombospondin

ProfileScan IPR002861 1 111 PS51019 Reeler region

IPR009465 112 305 PS51020 Spondin

IPR000884 359 412 PS50092 Thrombospondin

IPR000884 418 472 PS50092 Thrombospondin

IPR000884 475 528 PS50092 Thrombospondin

IPR000884 531 583 PS50092 Thrombospondin

IPR000884 585 638 PS50092 Thrombospondin

IPR000884 671 723 PS50092 Thrombospondin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002861	1	90	PF02014	Reeler region
IPR009465	91	332	PF06468	Spondin
IPR000884	363	411	PF00090	Thrombospondin
IPR000884	422	471	PF00090	Thrombospondin
IPR000884	479	527	PF00090	Thrombospondin
IPR000884	535	582	PF00090	Thrombospondin
IPR000884	589	637	PF00090	Thrombospondin
IPR000884	675	724	PF00090	Thrombospondin
HMMSmart	IPR000884	362	412	SM00209	Thrombospondin
IPR000884	421	472	SM00209	Thrombospondin
IPR000884	478	528	SM00209	Thrombospondin
IPR000884	534	583	SM00209	Thrombospondin
IPR000884	588	638	SM00209	Thrombospondin
IPR000884	674	723	SM00209	Thrombospondin
ProfileScan	IPR002861	1	111	PS51019	Reeler region
IPR009465	112	305	PS51020	Spondin
IPR000884	359	412	PS50092	Thrombospondin
IPR000884	418	472	PS50092	Thrombospondin
IPR000884	475	528	PS50092	Thrombospondin
IPR000884	531	583	PS50092	Thrombospondin
IPR000884	585	638	PS50092	Thrombospondin
IPR000884	671	723	PS50092	Thrombospondin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCAATGTTGTTCTAAGCTATC

Primer_r
: AACAATCCAACAAGAGTCATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCAATGTTGTTCTAAGCTATC
Primer_r	: AACAATCCAACAAGAGTCATG
PCR product length	: 202 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2124 bp
Genome contig ID	gi51511727f_13860979
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- CATTTTGGAAATAAAGATTTTTTACTACAAAAATG
Flanking genome sequence (384956 - 385005)	----+--------+--------+--------+--------+----* AAATTTGTTTGGACTTCCACTTGAGACAGTAAAGAGAGTATTAGACACCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	f	13960979	14245933	15	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0762

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information