HUGE

Gene/Protein Characteristic Table for KIAA0960

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07113
Accession No. :	AB023177
Description :	Thrombospondin type-1 domain-containing protein 7A precursor.
HUGO Gene Name :	thrombospondin, type I, domain containing 7A (THSD7A)
Clone Name :	hj05779s1 [Vector Info]
Source :	Human adult brain
Note :	We replaced hj05779, former representative clones for KIAA0960 with hj05779s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5669 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1159 bp

Genome contig ID gi89161213r_11280787
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ATGACTAGATTTTTATATTTGTTATCTTTGTTAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAGAAAAAGGAACTGGATGTCTTTTTAATTTTGAGCAGATGGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 r 11380787 11642839 26 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1502 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UPZ6	100.0	Thrombospondin ...	Homo sapiens
NP_056019	99.9	thrombospondin,...	Homo sapiens
EAW93637	98.2	hCG17390 [Homo ...	Homo sapiens
XP_001915637	94.1	similar to Thro...	Equus caballus
XP_001787380	92.6	similar to Thro...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051466	0	51.0	KIAA1679
AB037733	1.5e-12	22.4	KIAA1312
AB011177	4.8e-11	27.4	KIAA0605
AB018305	8.4e-10	27.0	KIAA0762
AB002364	1.2e-08	24.1	KIAA0366

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000884 43 91 PF00090 Thrombospondin

IPR000884 209 237 PF00090 Thrombospondin

IPR000884 361 418 PF00090 Thrombospondin

IPR000884 483 539 PF00090 Thrombospondin

IPR000884 620 675 PF00090 Thrombospondin

IPR000884 755 803 PF00090 Thrombospondin

IPR000884 884 935 PF00090 Thrombospondin

IPR000884 944 1007 PF00090 Thrombospondin

IPR000884 1014 1064 PF00090 Thrombospondin

IPR000884 1135 1185 PF00090 Thrombospondin

IPR000884 1263 1319 PF00090 Thrombospondin

HMMSmart IPR000884 42 92 SM00209 Thrombospondin

IPR000884 208 268 SM00209 Thrombospondin

IPR000884 271 355 SM00209 Thrombospondin

IPR000884 360 419 SM00209 Thrombospondin

IPR000884 482 540 SM00209 Thrombospondin

IPR000884 543 614 SM00209 Thrombospondin

IPR000884 619 676 SM00209 Thrombospondin

IPR000884 754 804 SM00209 Thrombospondin

IPR000884 883 940 SM00209 Thrombospondin

IPR000884 943 1008 SM00209 Thrombospondin

IPR000884 1013 1065 SM00209 Thrombospondin

IPR000884 1068 1129 SM00209 Thrombospondin

IPR000884 1134 1186 SM00209 Thrombospondin

IPR000884 1187 1257 SM00209 Thrombospondin

IPR000884 1262 1320 SM00209 Thrombospondin

ProfileScan IPR000884 39 92 PS50092 Thrombospondin

IPR000884 205 261 PS50092 Thrombospondin

IPR000884 268 355 PS50092 Thrombospondin

IPR000884 357 419 PS50092 Thrombospondin

IPR000884 479 540 PS50092 Thrombospondin

IPR000884 541 614 PS50092 Thrombospondin

IPR000884 616 676 PS50092 Thrombospondin

IPR000884 751 804 PS50092 Thrombospondin

IPR000884 880 1065 PS50092 Thrombospondin

IPR000884 1131 1186 PS50092 Thrombospondin

IPR000884 1259 1320 PS50092 Thrombospondin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000884	43	91	PF00090	Thrombospondin
IPR000884	209	237	PF00090	Thrombospondin
IPR000884	361	418	PF00090	Thrombospondin
IPR000884	483	539	PF00090	Thrombospondin
IPR000884	620	675	PF00090	Thrombospondin
IPR000884	755	803	PF00090	Thrombospondin
IPR000884	884	935	PF00090	Thrombospondin
IPR000884	944	1007	PF00090	Thrombospondin
IPR000884	1014	1064	PF00090	Thrombospondin
IPR000884	1135	1185	PF00090	Thrombospondin
IPR000884	1263	1319	PF00090	Thrombospondin
HMMSmart	IPR000884	42	92	SM00209	Thrombospondin
IPR000884	208	268	SM00209	Thrombospondin
IPR000884	271	355	SM00209	Thrombospondin
IPR000884	360	419	SM00209	Thrombospondin
IPR000884	482	540	SM00209	Thrombospondin
IPR000884	543	614	SM00209	Thrombospondin
IPR000884	619	676	SM00209	Thrombospondin
IPR000884	754	804	SM00209	Thrombospondin
IPR000884	883	940	SM00209	Thrombospondin
IPR000884	943	1008	SM00209	Thrombospondin
IPR000884	1013	1065	SM00209	Thrombospondin
IPR000884	1068	1129	SM00209	Thrombospondin
IPR000884	1134	1186	SM00209	Thrombospondin
IPR000884	1187	1257	SM00209	Thrombospondin
IPR000884	1262	1320	SM00209	Thrombospondin
ProfileScan	IPR000884	39	92	PS50092	Thrombospondin
IPR000884	205	261	PS50092	Thrombospondin
IPR000884	268	355	PS50092	Thrombospondin
IPR000884	357	419	PS50092	Thrombospondin
IPR000884	479	540	PS50092	Thrombospondin
IPR000884	541	614	PS50092	Thrombospondin
IPR000884	616	676	PS50092	Thrombospondin
IPR000884	751	804	PS50092	Thrombospondin
IPR000884	880	1065	PS50092	Thrombospondin
IPR000884	1131	1186	PS50092	Thrombospondin
IPR000884	1259	1320	PS50092	Thrombospondin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 1452 WVYGVAAGAFVLLIFIVSMIYLA 1474 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1452	WVYGVAAGAFVLLIFIVSMIYLA	1474	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CACTTCCTCATCACTGCAGCC

Primer_r
: AACCAACTAGAGGAATCCACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CACTTCCTCATCACTGCAGCC
Primer_r	: AACCAACTAGAGGAATCCACC
PCR product length	: 108 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1159 bp
Genome contig ID	gi89161213r_11280787
PolyA signal sequence (None)	+--------+--------+----*----+---- ATGACTAGATTTTTATATTTGTTATCTTTGTTAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAGAAAAAGGAACTGGATGTCTTTTTAATTTTGAGCAGATGGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	r	11380787	11642839	26	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0960

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information