HUGE |
Gene/Protein Characteristic Table for KIAA0960 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK07113 |
---|---|
Accession No. : | AB023177 |
Description : | Thrombospondin type-1 domain-containing protein 7A precursor. |
HUGO Gene Name : | thrombospondin, type I, domain containing 7A (THSD7A) |
Clone Name : | hj05779s1 [Vector Info] |
Source : | Human adult brain |
Note : | We replaced hj05779, former representative clones for KIAA0960 with hj05779s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5669 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1159 bp Genome contig ID gi89161213r_11280787 PolyA signal sequence
(None) +----*----+----*----+----*----+----
ATGACTAGATTTTTATATTTGTTATCTTTGTTAAGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAGAAAAAGGAACTGGATGTCTTTTTAATTTTGAGCAGATGGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 r 11380787 11642839 26 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1502 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CACTTCCTCATCACTGCAGCC | |
: AACCAACTAGAGGAATCCACC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 7 |
: GeneBridge 4 | |
: CACTTCCTCATCACTGCAGCC | |
: AACCAACTAGAGGAATCCACC | |
: 108 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |