HUGE |
Gene/Protein Characteristic Table for KIAA1679 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK07114 |
---|---|
Accession No. : | AB051466 |
Description : | Thrombospondin type-1 domain-containing protein 7B precursor. |
HUGO Gene Name : | thrombospondin, type I, domain containing 7B (THSD7B) |
Clone Name : | fh22954 [Vector Info] |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5724 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1112 bp Genome contig ID gi89161199f_137430536 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
TGTATTTATAACAAATAAACTGCTCAAGAGACTGCFlanking genome sequence
(721223 - 721272) ----+----*----+----*----+----*----+----*----+----*
AGTGTTGGCTGTTCTAGATTTATTCACTTCTGAAGTGCCTTGCCCTTGCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 f 137530536 138151757 26 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1536 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CATGCCAGCTGAGTGAAAACG | |
: GAGAGCTGACAGTTGACCACG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 2 |
: CCR | |
: CATGCCAGCTGAGTGAAAACG | |
: GAGAGCTGACAGTTGACCACG | |
: 178(2.0k) bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |