HUGE

Gene/Protein Characteristic Table for KIAA0023

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00369
Accession No. :	D14689
Description :	Nuclear pore complex protein Nup214.
HUGO Gene Name :
Clone Name :	ha00512 [Vector Info]
Flexi ORF Clone :	pF1KSDA0023
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 6642 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 305 bp

Genome contig ID gi89161216f_132890858
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
GTTTTCCCTCCCACTATTAAACAGTCTGTTTCCGT
Flanking genome sequence
(208053 - 208102)
----+----*----+----*----+----*----+----*----+----*
ACAGAACGTATGTGGGTTTTTTCAGATCACAGCCAAGAAGATTGCCCCGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 f 132990858 133098909 37 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 2111 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_238325	75.2	similar to nucl...	Rattus norvegicus
EAW87963	99.5	nucleoporin 214...	Homo sapiens
XP_001167010	98.3	nucleoporin 214...	Pan troglodytes
XP_001166949	98.4	nucleoporin 214...	Pan troglodytes
EAW87960	99.8	nucleoporin 214...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014518	1.4e-06	26.2	KIAA0618

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR001680 156 196 SM00320 WD40 repeat

IPR001680 200 238 SM00320 WD40 repeat

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR001680	156	196	SM00320	WD40 repeat
IPR001680	200	238	SM00320	WD40 repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TACCCCCTCCCTGCCTATGT
Primer_r	: GGCTGACTGTTGCTCCTCTA
PCR product length	: 130 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	305 bp
Genome contig ID	gi89161216f_132890858
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- GTTTTCCCTCCCACTATTAAACAGTCTGTTTCCGT
Flanking genome sequence (208053 - 208102)	----+--------+--------+--------+--------+----* ACAGAACGTATGTGGGTTTTTTCAGATCACAGCCAAGAAGATTGCCCCGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	f	132990858	133098909	37	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0023

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information