HUGE

Gene/Protein Characteristic Table for KIAA0618

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05613
Accession No. :	AB014518
Description :	nuclear pore membrane protein 121.
HUGO Gene Name :	POM121 membrane glycoprotein (rat) (POM121)
Clone Name :	hg03971 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 7011 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2970 bp

Genome contig ID gi89161213f_71887872
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
GCAGGACATGCCTTGTTAATAAAACGTTTACAAGC
Flanking genome sequence
(172045 - 172094)
----+----*----+----*----+----*----+----*----+----*
AGTATGCTTGGTAAAAGTCTTCGCCGTTCTCTAGTCTCAATAAACCAGAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 f 71987872 72059915 16 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 1052 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96HA1	99.9	Nuclear envelop...	Homo sapiens
A8CG34	97.1	Nuclear envelop...	Homo sapiens
AAH08794	99.9	POM121 membrane...	Homo sapiens
BAF85237	99.7	unnamed protein...	Homo sapiens
XP_001110260	93.2	nuclear pore me...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D14689	5.5e-06	26.1	KIAA0023
AB029037	0.00073	27.8	KIAA1114
AB051468	0.00082	23.9	KIAA1681

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCGACCCATGCAGAAATAGGC

Primer_r
: CCTTCTGCCCTACCATGTTGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCGACCCATGCAGAAATAGGC
Primer_r	: CCTTCTGCCCTACCATGTTGC
PCR product length	: 141 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2970 bp
Genome contig ID	gi89161213f_71887872
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GCAGGACATGCCTTGTTAATAAAACGTTTACAAGC
Flanking genome sequence (172045 - 172094)	----+--------+--------+--------+--------+----* AGTATGCTTGGTAAAAGTCTTCGCCGTTCTCTAGTCTCAATAAACCAGAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	f	71987872	72059915	16	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0618

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information