HUGE

Gene/Protein Characteristic Table for KIAA0050

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00386
Accession No. :	D30758
Description :	Centaurin-beta 1.
HUGO Gene Name :	ArfGAP with coiled-coil, ankyrin repeat and PH domains 1 (ACAP1)
Clone Name :	ha01557 [Vector Info]
Flexi ORF Clone :	pF1KSDA0050
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 2494 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 83 bp

Genome contig ID gi51511734f_7080590
PolyA signal sequence
(ATTAAA,-27)
+----*----+----*----+----*----+----
CCTCTGCCATTAAAGCCTCCGTGCTTCGCTCTTCC
Flanking genome sequence
(114933 - 114982)
----+----*----+----*----+----*----+----*----+----*
CTTCTGGTTCACTTCTTGGGCGCCACCTTCGGGCCCGTAGGGTGTTGGGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 7180590 7195521 22 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 796 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q15027	100.0	ARFGAP with coi...	Homo sapiens
A5PK26	93.7	ARFGAP with coi...	Bos taurus
Q8K2H4	93.1	ARFGAP with coi...	Mus musculus
BAE32594	93.0	unnamed protein...	Mus musculus
XP_001169930	98.3	centaurin beta1...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D26069	3.2e-58	51.5	KIAA0041
AB051503	5.6e-55	49.5	KIAA1716
AB029022	2.6e-09	35.8	KIAA1099
AB075855	3.1e-09	37.6	KIAA1975
D79989	1.9e-08	35.1	KIAA0167

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001164 473 492 PR00405 Arf GTPase activating protein

IPR001164 492 509 PR00405 Arf GTPase activating protein

IPR001164 513 534 PR00405 Arf GTPase activating protein

IPR002110 696 708 PR01415 Ankyrin

IPR002110 708 720 PR01415 Ankyrin

HMMPfam IPR001849 322 416 PF00169 Pleckstrin-like

IPR001164 461 583 PF01412 Arf GTPase activating protein

IPR002110 662 694 PF00023 Ankyrin

IPR002110 695 727 PF00023 Ankyrin

IPR002110 728 748 PF00023 Ankyrin

HMMSmart IPR001849 322 418 SM00233 Pleckstrin-like

IPR001164 461 583 SM00105 Arf GTPase activating protein

IPR002110 662 691 SM00248 Ankyrin

IPR002110 695 724 SM00248 Ankyrin

IPR002110 728 758 SM00248 Ankyrin

ProfileScan IPR000909 132 196 PS50007 Phosphatidylinositol-specific phospholipase C

IPR001849 321 416 PS50003 Pleckstrin-like

IPR001164 461 583 PS50115 Arf GTPase activating protein

IPR002110 648 748 PS50297 Ankyrin

IPR002110 662 694 PS50088 Ankyrin

IPR002110 695 727 PS50088 Ankyrin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001164	473	492	PR00405	Arf GTPase activating protein
IPR001164	492	509	PR00405	Arf GTPase activating protein
IPR001164	513	534	PR00405	Arf GTPase activating protein
IPR002110	696	708	PR01415	Ankyrin
IPR002110	708	720	PR01415	Ankyrin
HMMPfam	IPR001849	322	416	PF00169	Pleckstrin-like
IPR001164	461	583	PF01412	Arf GTPase activating protein
IPR002110	662	694	PF00023	Ankyrin
IPR002110	695	727	PF00023	Ankyrin
IPR002110	728	748	PF00023	Ankyrin
HMMSmart	IPR001849	322	418	SM00233	Pleckstrin-like
IPR001164	461	583	SM00105	Arf GTPase activating protein
IPR002110	662	691	SM00248	Ankyrin
IPR002110	695	724	SM00248	Ankyrin
IPR002110	728	758	SM00248	Ankyrin
ProfileScan	IPR000909	132	196	PS50007	Phosphatidylinositol-specific phospholipase C
IPR001849	321	416	PS50003	Pleckstrin-like
IPR001164	461	583	PS50115	Arf GTPase activating protein
IPR002110	648	748	PS50297	Ankyrin
IPR002110	662	694	PS50088	Ankyrin
IPR002110	695	727	PS50088	Ankyrin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TTTGTGCTGCGTTTGGTGGAG
Primer_r	: GTCCCTCTTCTCTCGTGCTGA
PCR product length	: 141 (0.2k) bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	83 bp
Genome contig ID	gi51511734f_7080590
PolyA signal sequence (ATTAAA,-27)	+--------+--------+----*----+---- CCTCTGCCATTAAAGCCTCCGTGCTTCGCTCTTCC
Flanking genome sequence (114933 - 114982)	----+--------+--------+--------+--------+----* CTTCTGGTTCACTTCTTGGGCGCCACCTTCGGGCCCGTAGGGTGTTGGGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	7180590	7195521	22	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0050

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information