HUGE

Gene/Protein Characteristic Table for KIAA0068

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01053
Accession No. :	D38549
Description :	Cytoplasmic FMR1-interacting protein 1.
HUGO Gene Name :	cytoplasmic FMR1 interacting protein 1 (CYFIP1)
Clone Name :	ha01025 [Vector Info]
Flexi ORF Clone :	pF1KA0068
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 4379 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 562 bp

Genome contig ID gi51511731f_20344174
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
ATCGAAAGGTTATAGAAATAAAACTAATGAGATCT
Flanking genome sequence
(210871 - 210920)
----+----*----+----*----+----*----+----*----+----*
ATTTGTGTTCATTTATTTACTCTAACCCTGTGCTGCCTGGCTTGGCAAGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 f 20444174 20555043 31 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1271 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q7L576	100.0	Cytoplasmic FMR...	Homo sapiens
EDL86460	99.2	cytoplasmic FMR...	Rattus norvegicus
Q7TMB8	99.0	Cytoplasmic FMR...	Mus musculus
AAH47135	99.0	Cytoplasmic FMR...	Mus musculus
XP_001790637	99.0	similar to cyto...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032994	0	85.0	KIAA1168

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR008081 62 79 PR01698 Cytoplasmic fragile X mental retardation protein interacting protein

IPR008081 117 133 PR01698 Cytoplasmic fragile X mental retardation protein interacting protein

IPR008081 157 186 PR01698 Cytoplasmic fragile X mental retardation protein interacting protein

IPR008081 278 293 PR01698 Cytoplasmic fragile X mental retardation protein interacting protein

IPR008081 450 468 PR01698 Cytoplasmic fragile X mental retardation protein interacting protein

IPR008081 570 593 PR01698 Cytoplasmic fragile X mental retardation protein interacting protein

IPR008081 633 651 PR01698 Cytoplasmic fragile X mental retardation protein interacting protein

IPR008081 702 724 PR01698 Cytoplasmic fragile X mental retardation protein interacting protein

IPR008081 762 792 PR01698 Cytoplasmic fragile X mental retardation protein interacting protein

IPR008081 1098 1122 PR01698 Cytoplasmic fragile X mental retardation protein interacting protein

IPR008081 1144 1160 PR01698 Cytoplasmic fragile X mental retardation protein interacting protein

IPR008081 1219 1233 PR01698 Cytoplasmic fragile X mental retardation protein interacting protein

HMMPfam IPR008081 19 1271 PF05994 Cytoplasmic fragile X mental retardation protein interacting protein

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR008081	62	79	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
IPR008081	117	133	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
IPR008081	157	186	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
IPR008081	278	293	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
IPR008081	450	468	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
IPR008081	570	593	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
IPR008081	633	651	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
IPR008081	702	724	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
IPR008081	762	792	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
IPR008081	1098	1122	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
IPR008081	1144	1160	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
IPR008081	1219	1233	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
HMMPfam	IPR008081	19	1271	PF05994	Cytoplasmic fragile X mental retardation protein interacting protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: CTACCAGCCAAATTTCAACAC
Primer_r	: TCATGCTAGAGTGGACGGTGG
PCR product length	: 98 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	562 bp
Genome contig ID	gi51511731f_20344174
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- ATCGAAAGGTTATAGAAATAAAACTAATGAGATCT
Flanking genome sequence (210871 - 210920)	----+--------+--------+--------+--------+----* ATTTGTGTTCATTTATTTACTCTAACCCTGTGCTGCCTGGCTTGGCAAGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	f	20444174	20555043	31	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA0068

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information