HUGE

Gene/Protein Characteristic Table for KIAA1168

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK00193
Accession No. :	AB032994
Description :	Cytoplasmic FMR1-interacting protein 2.
HUGO Gene Name :
Clone Name :	hk07410 [Vector Info]
Flexi ORF Clone :	pF1KA1168
Source :	Human adult brain
Note :	We replaced hk08280, former representative clones for KIAA1168 with hk07410. (2007/2/9)

Features of the cloned DNA sequence	Description

Length: 4149 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 233 bp

Genome contig ID gi51511721f_156525728
PolyA signal sequence
(AGTAAA,-10)
+----*----+----*----+----*----+----
GCATAAATGAAAAAAAAAAAAAAAAAGTAAACAGG
Flanking genome sequence
(227093 - 227142)
----+----*----+----*----+----*----+----*----+----*
GCAGTGTGTGCTTTTTCTTTTCTCCCCCCTCAACTATATTAAGAACTCCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 156625728 156752819 32 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1304 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001105005	99.6	similar to cyto...	Macaca mulatta
XP_536455	99.6	similar to p53 ...	Canis lupus fam...
BAG10431	100.0	cytoplasmic FMR...	synthetic construct
Q96F07	99.9	Cytoplasmic FMR...	Homo sapiens
XP_001136888	99.9	cytoplasmic FMR...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D38549	0	85.0	KIAA0068

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR008081 70 87 PR01698 Cytoplasmic fragile X mental retardation protein interacting protein

IPR008081 125 141 PR01698 Cytoplasmic fragile X mental retardation protein interacting protein

IPR008081 165 194 PR01698 Cytoplasmic fragile X mental retardation protein interacting protein

IPR008081 286 301 PR01698 Cytoplasmic fragile X mental retardation protein interacting protein

IPR008081 602 625 PR01698 Cytoplasmic fragile X mental retardation protein interacting protein

IPR008081 665 683 PR01698 Cytoplasmic fragile X mental retardation protein interacting protein

IPR008081 734 756 PR01698 Cytoplasmic fragile X mental retardation protein interacting protein

IPR008081 794 824 PR01698 Cytoplasmic fragile X mental retardation protein interacting protein

IPR008081 1130 1154 PR01698 Cytoplasmic fragile X mental retardation protein interacting protein

IPR008081 1176 1192 PR01698 Cytoplasmic fragile X mental retardation protein interacting protein

IPR008081 1251 1265 PR01698 Cytoplasmic fragile X mental retardation protein interacting protein

HMMPfam IPR008081 27 1304 PF05994 Cytoplasmic fragile X mental retardation protein interacting protein

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR008081	70	87	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
IPR008081	125	141	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
IPR008081	165	194	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
IPR008081	286	301	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
IPR008081	602	625	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
IPR008081	665	683	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
IPR008081	734	756	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
IPR008081	794	824	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
IPR008081	1130	1154	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
IPR008081	1176	1192	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
IPR008081	1251	1265	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
HMMPfam	IPR008081	27	1304	PF05994	Cytoplasmic fragile X mental retardation protein interacting protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	233 bp
Genome contig ID	gi51511721f_156525728
PolyA signal sequence (AGTAAA,-10)	+--------+--------+----*----+---- GCATAAATGAAAAAAAAAAAAAAAAAGTAAACAGG
Flanking genome sequence (227093 - 227142)	----+--------+--------+--------+--------+----* GCAGTGTGTGCTTTTTCTTTTCTCCCCCCTCAACTATATTAAGAACTCCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	156625728	156752819	32	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA1168

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information