HUGE

Gene/Protein Characteristic Table for KIAA0071

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06618
Accession No. :	D31888
Description :	REST corepressor 1.
HUGO Gene Name :	REST corepressor 1 (RCOR1)
Clone Name :	ha00472 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 5241 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4050 bp

Genome contig ID gi51511730f_102029355
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
GAGGGGTTAAATAAAAATTTTCAAGCCATTGATGT
Flanking genome sequence
(237291 - 237340)
----+----*----+----*----+----*----+----*----+----*
AATAAAATATGAAATGAAAGCATTTTCTGCACCCCCACGCTCCATCAAAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 f 102129244 102266644 12 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 396 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9UKL0	2.9e-150	100.0	REST corepresso...	Homo sapiens
EAW81793	2.9e-150	100.0	REST corepresso...	Homo sapiens
EAW81794	7.7e-146	100.0	REST corepresso...	Homo sapiens
Q8CFE3	2.3e-145	96.2	REST corepresso...	Mus musculus
XP_001927812	7.1e-145	95.5	similar to REST...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037764	2.8e-40	64.4	KIAA1343
AB028970	1.6e-10	25.8	KIAA1047
AB033092	0.00054	26.6	KIAA1266

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000949 14 78 PF01448 ELM2

IPR014778 103 148 PF00249 Myb

IPR014778 294 339 PF00249 Myb

HMMSmart IPR001005 102 150 SM00717 SANT

IPR001005 293 341 SM00717 SANT

ProfileScan IPR000949 14 100 PS51156 ELM2

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000949	14	78	PF01448	ELM2
IPR014778	103	148	PF00249	Myb
IPR014778	294	339	PF00249	Myb
HMMSmart	IPR001005	102	150	SM00717	SANT
IPR001005	293	341	SM00717	SANT
ProfileScan	IPR000949	14	100	PS51156	ELM2

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: Stanford G3
Primer_f	: GTTTCCTCAGATACCACAGAC
Primer_r	: GAGCATCGCACAGGACCACTA
PCR product length	: 337 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4050 bp
Genome contig ID	gi51511730f_102029355
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- GAGGGGTTAAATAAAAATTTTCAAGCCATTGATGT
Flanking genome sequence (237291 - 237340)	----+--------+--------+--------+--------+----* AATAAAATATGAAATGAAAGCATTTTCTGCACCCCCACGCTCCATCAAAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	f	102129244	102266644	12	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0071

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information