HUGE |
Gene/Protein Characteristic Table for KIAA0071 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK06618 |
---|---|
Accession No. : | D31888 |
Description : | REST corepressor 1. |
HUGO Gene Name : | REST corepressor 1 (RCOR1) |
Clone Name : | ha00472 [Vector Info] |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5241 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 4050 bp Genome contig ID gi51511730f_102029355 PolyA signal sequence
(AATAAA,-26) +----*----+----*----+----*----+----
GAGGGGTTAAATAAAAATTTTCAAGCCATTGATGTFlanking genome sequence
(237291 - 237340) ----+----*----+----*----+----*----+----*----+----*
AATAAAATATGAAATGAAAGCATTTTCTGCACCCCCACGCTCCATCAAAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 14 f 102129244 102266644 12 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 396 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 14 |
: Stanford G3 | |
: GTTTCCTCAGATACCACAGAC | |
: GAGCATCGCACAGGACCACTA | |
: 337 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |