| HUGE |
Gene/Protein Characteristic Table for KIAA1047 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Mapping | |
| Product ID : | ORK00170 |
|---|---|
| Accession No. : | AB028970 |
| Description : | Nuclear receptor corepressor 1. |
| HUGO Gene Name : | nuclear receptor co-repressor 1 (NCOR1) |
| Clone Name : | hh01221s1 [Vector Info] |
| Flexi ORF Clone : | pF1KA1047
|
| Source : | Human adult brain |
| Note : | We replaced hh01221, former representative clones for KIAA1047 with hh01221s1. (2003/4/2) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 7949 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 891 bp Genome contig ID gi51511734r_15775444 PolyA signal sequence
(AATAAA,-24)
TTTTGTTTTGAAATAAATTTGACTACCCTGTCCATFlanking genome sequence
(100000 - 99951)
AGCTACAGTAGATTATTTGTGGTTTAAGGCTCCTGGTGTCTCAGGTTCCA
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 r 15875444 16038652 45 100.0 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 2348 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
|---|---|---|
| : 17 |
| : GeneBridge 4 | |
| : TTGTAAATTTCCAGTGCAGGC | |
| : GTGCGTAACAGTGAGGTATGC | |
| : 135 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
