HUGE |
Gene/Protein Characteristic Table for KIAA1266 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00789 |
---|---|
Accession No. : | AB033092 |
Description : | Metastasis-associated protein MTA3. |
HUGO Gene Name : | metastasis associated 1 family, member 3 (MTA3) |
Clone Name : | hj06235 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1266
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5484 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3548 bp Genome contig ID gi89161199f_42548689 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
TTGTATTGTGTTTCCAATAAATTCCTGGAAATTTTFlanking genome sequence
(288903 - 288952) ----+----*----+----*----+----*----+----*----+----*
GCCTGGTTTTATGCTGTTCTTTACTAGGATGATGGCTCAGGTGTAAGACT
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 f 42648689 42837590 17 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 601 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CCTGTTCCTCTGCACTATGTC | |
: CCTTACAGACAGACAATCCAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 2 |
: GeneBridge 4 | |
: CCTGTTCCTCTGCACTATGTC | |
: CCTTACAGACAGACAATCCAC | |
: 137 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |