HUGE

Gene/Protein Characteristic Table for KIAA1266

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00789
Accession No. :	AB033092
Description :	Metastasis-associated protein MTA3.
HUGO Gene Name :	metastasis associated 1 family, member 3 (MTA3)
Clone Name :	hj06235 [Vector Info]
Flexi ORF Clone :	pF1KSDA1266
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5484 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3548 bp

Genome contig ID gi89161199f_42548689
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TTGTATTGTGTTTCCAATAAATTCCTGGAAATTTT
Flanking genome sequence
(288903 - 288952)
----+----*----+----*----+----*----+----*----+----*
GCCTGGTTTTATGCTGTTCTTTACTAGGATGATGGCTCAGGTGTAAGACT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 42648689 42837590 17 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 601 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001110956	100.0	metastasis asso...	Macaca mulatta
Q9BTC8	99.8	Metastasis-asso...	Homo sapiens
XP_001110843	100.0	metastasis asso...	Macaca mulatta
XP_515434	99.8	metastasis asso...	Pan troglodytes
XP_532947	96.6	similar to Meta...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007927	9.3e-19	26.3	KIAA0458
D31888	1.4e-05	26.6	KIAA0071
AB037764	5e-05	24.4	KIAA1343
AB046830	0.00013	23.7	KIAA1610
AB033019	0.00042	27.0	KIAA1193

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001025 18 155 PF01426 Bromo adjacent region

IPR000949 156 217 PF01448 ELM2

IPR014778 276 322 PF00249 Myb

IPR000679 386 423 PF00320 Zinc finger

HMMSmart IPR001025 12 155 SM00439 Bromo adjacent region

IPR001005 275 324 SM00717 SANT

IPR000679 380 434 SM00401 Zinc finger

ProfileScan IPR001025 12 155 PS51038 Bromo adjacent region

IPR000949 156 267 PS51156 ELM2

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001025	18	155	PF01426	Bromo adjacent region
IPR000949	156	217	PF01448	ELM2
IPR014778	276	322	PF00249	Myb
IPR000679	386	423	PF00320	Zinc finger
HMMSmart	IPR001025	12	155	SM00439	Bromo adjacent region
IPR001005	275	324	SM00717	SANT
IPR000679	380	434	SM00401	Zinc finger
ProfileScan	IPR001025	12	155	PS51038	Bromo adjacent region
IPR000949	156	267	PS51156	ELM2

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCTGTTCCTCTGCACTATGTC

Primer_r
: CCTTACAGACAGACAATCCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCTGTTCCTCTGCACTATGTC
Primer_r	: CCTTACAGACAGACAATCCAC
PCR product length	: 137 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3548 bp
Genome contig ID	gi89161199f_42548689
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTGTATTGTGTTTCCAATAAATTCCTGGAAATTTT
Flanking genome sequence (288903 - 288952)	----+--------+--------+--------+--------+----* GCCTGGTTTTATGCTGTTCTTTACTAGGATGATGGCTCAGGTGTAAGACT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	42648689	42837590	17	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA1266

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information