HUGE

Gene/Protein Characteristic Table for KIAA1610

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05992
Accession No. :	AB046830
Description :	Mesoderm induction early response protein 1.
HUGO Gene Name :	mesoderm induction early response 1 homolog (Xenopus laevis) (MIER1)
Clone Name :	fj11544 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4585 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3128 bp

Genome contig ID gi89161185f_67084469
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TATGTTTTGCAAAATAAAACTTGTTTTGTCACAAT
Flanking genome sequence
(141834 - 141883)
----+----*----+----*----+----*----+----*----+----*
ATTTTCTTTGCTATCGATGGATAATTAGGAGTGGGCACTTGGAATAACTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 67184469 67226301 11 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 484 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001163423	5.6e-169	100.0	mesoderm induct...	Pan troglodytes
EAX06509	5.8e-169	100.0	mesoderm induct...	Homo sapiens
AAM76041	5.8e-169	100.0	mesoderm induct...	Homo sapiens
AAM76040	5.9e-169	100.0	mesoderm induct...	Homo sapiens
CAI18875	6e-169	100.0	mesoderm induct...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033019	7.2e-32	44.6	KIAA1193

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000949 152 211 PF01448 ELM2

IPR014778 257 303 PF00249 Myb

HMMSmart IPR001005 256 305 SM00717 SANT

ProfileScan IPR000949 152 250 PS51156 ELM2

ScanRegExp IPR002048 4 16 PS00018 Calcium-binding EF-hand

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000949	152	211	PF01448	ELM2
IPR014778	257	303	PF00249	Myb
HMMSmart	IPR001005	256	305	SM00717	SANT
ProfileScan	IPR000949	152	250	PS51156	ELM2
ScanRegExp	IPR002048	4	16	PS00018	Calcium-binding EF-hand

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTTCAGTGGTTCTTGGTCCCC

Primer_r
: GAACTCCACTACAAAATACGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3128 bp
Genome contig ID	gi89161185f_67084469
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TATGTTTTGCAAAATAAAACTTGTTTTGTCACAAT
Flanking genome sequence (141834 - 141883)	----+--------+--------+--------+--------+----* ATTTTCTTTGCTATCGATGGATAATTAGGAGTGGGCACTTGGAATAACTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	67184469	67226301	11	99.1	Perfect prediction

Primer_f	: TTTCAGTGGTTCTTGGTCCCC
Primer_r	: GAACTCCACTACAAAATACGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1610

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information