HUGE

Gene/Protein Characteristic Table for KIAA1193

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00759
Accession No. :	AB033019
Description :	mesoderm induction early response 1, family member 2.
HUGO Gene Name :
Clone Name :	fg00739 [Vector Info]
Flexi ORF Clone :	pF1KSDA1193
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 7118 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1337 bp

Genome contig ID gi42406306r_152444
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GGTGCATTTTAACAGATTTTGAAGTCTTGACTGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTCTGCAGATATTTCTGTTTTCTTTTGCTTTCTTAGAGTTCCATTTCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 r 252444 287179 15 98.5 Internal No-hit

Features of the protein sequence	Description

Length: 544 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8N344	1.5e-200	100.0	Mesoderm induct...	Homo sapiens
XP_001090898	2.8e-190	95.6	similar to CG16...	Macaca mulatta
Q3U3N0	9.3e-158	81.3	Mesoderm induct...	Mus musculus
EDL31693	1.6e-157	80.7	mesoderm induct...	Mus musculus
AAH67013	3.1e-156	80.9	Mesoderm induct...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046830	3.5e-32	44.6	KIAA1610

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000949 194 252 PF01448 ELM2

IPR014778 298 344 PF00249 Myb

HMMSmart IPR001005 297 346 SM00717 SANT

ProfileScan IPR000949 194 291 PS51156 ELM2

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000949	194	252	PF01448	ELM2
IPR014778	298	344	PF00249	Myb
HMMSmart	IPR001005	297	346	SM00717	SANT
ProfileScan	IPR000949	194	291	PS51156	ELM2

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGAGGAAGAGACGCAATCATC

Primer_r
: AGCTGGTCTTCGTTCTCGTAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GTAACGTGATGACCTGCTGAC
Primer_r	: AGTCCTGACGTGTTCTGAAGC
PCR product length	: 161&(600) bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1337 bp
Genome contig ID	gi42406306r_152444
PolyA signal sequence (None)	+--------+--------+----*----+---- GGTGCATTTTAACAGATTTTGAAGTCTTGACTGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTCTGCAGATATTTCTGTTTTCTTTTGCTTTCTTAGAGTTCCATTTCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	r	252444	287179	15	98.5	Internal No-hit

Primer_f	: AGAGGAAGAGACGCAATCATC
Primer_r	: AGCTGGTCTTCGTTCTCGTAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1193

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information