HUGE |
Gene/Protein Characteristic Table for KIAA0136 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK06020 |
---|---|
Accession No. : | D50926 |
Description : | MORC family CW-type zinc finger protein 3. |
HUGO Gene Name : | MORC family CW-type zinc finger 3 (MORC3) |
Clone Name : | ha03621s1 [Vector Info] |
Flexi ORF Clone : | pF1KA0136
![]() |
Source : | Myeloblast cell line (KG-1) |
Note : | We replaced ha03621, former representative clones for KIAA0136 with ha03621s1. (2008/8/27) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4197 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1342 bp Genome contig ID gi51511750f_36514398 PolyA signal sequence
(AATAAA,-28) +----*----+----*----+----*----+----
ATAATAAAATAAAAATATATGATGGCTAACTGTTCFlanking genome sequence
(156410 - 156459) ----+----*----+----*----+----*----+----*----+----*
AAATGCTACTTTTAAAGACTTAATATTAACCTCAAATTATTTTAAAACTA
Features of the protein sequence |
Description | |
---|---|---|
Length: 950 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 21 |
: Stanford G3 | |
: CGACAATGGGAATGGTATGAC | |
: TGCTCCGCTTTTATGACTTTC | |
: 228 (0.9k) bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |