HUGE

Gene/Protein Characteristic Table for KIAA0136

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06020
Accession No. :	D50926
Description :	MORC family CW-type zinc finger protein 3.
HUGO Gene Name :	MORC family CW-type zinc finger 3 (MORC3)
Clone Name :	ha03621s1 [Vector Info]
Flexi ORF Clone :	pF1KA0136
Source :	Myeloblast cell line (KG-1)
Note :	We replaced ha03621, former representative clones for KIAA0136 with ha03621s1. (2008/8/27)

Features of the cloned DNA sequence	Description

Length: 4197 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1342 bp

Genome contig ID gi51511750f_36514398
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
ATAATAAAATAAAAATATATGATGGCTAACTGTTC
Flanking genome sequence
(156410 - 156459)
----+----*----+----*----+----*----+----*----+----*
AAATGCTACTTTTAAAGACTTAATATTAACCTCAAATTATTTTAAAACTA

Features of the protein sequence	Description

Length: 950 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14149	100.0	MORC family CW-...	Homo sapiens
AAH94779	99.9	MORC family CW-...	Homo sapiens
AAI32732	99.9	MORC3 protein [...	Homo sapiens
XP_514887	99.7	MORC family CW-...	Pan troglodytes
EAX09742	99.6	MORC family CW-...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020659	5.5e-11	25.2	KIAA0852

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003594 35 97 PF02518 ATP-binding region

IPR011124 419 464 PF07496 Zinc finger

ProfileScan IPR011124 415 465 PS51050 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003594	35	97	PF02518	ATP-binding region
IPR011124	419	464	PF07496	Zinc finger
ProfileScan	IPR011124	415	465	PS51050	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 21

Experimental conditions

Panel name	: Stanford G3
Primer_f	: CGACAATGGGAATGGTATGAC
Primer_r	: TGCTCCGCTTTTATGACTTTC
PCR product length	: 228 (0.9k) bp
PCR conditions	: 95 °C15 sec66 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1342 bp
Genome contig ID	gi51511750f_36514398
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- ATAATAAAATAAAAATATATGATGGCTAACTGTTC
Flanking genome sequence (156410 - 156459)	----+--------+--------+--------+--------+----* AAATGCTACTTTTAAAGACTTAATATTAACCTCAAATTATTTTAAAACTA

Gene/Protein Characteristic Table for KIAA0136

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information