HUGE

Gene/Protein Characteristic Table for KIAA0852

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01128
Accession No. :	AB020659
Description :	MORC family CW-type zinc finger protein 2.
HUGO Gene Name :	MORC family CW-type zinc finger 2 (MORC2)
Clone Name :	hk06101 [Vector Info]
Flexi ORF Clone :	pF1KA0852
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4467 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 190 bp

Genome contig ID gi89161203r_29552600
PolyA signal sequence
(TATAAA,-23)
+----*----+----*----+----*----+----
CTTCCTTAAGTTTATAAATATTTATTTTTTAAAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGATGCTGTGCCTGTGAGACCATACTTTTTTTTTTTTTTTTTTTTTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 22 r 29652600 29694187 27 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1017 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y6X9	100.0	MORC family CW-...	Homo sapiens
XP_001110598	99.2	MORC family CW-...	Macaca mulatta
XP_515079	98.3	MORC family CW-...	Pan troglodytes
CAG30355	100.0	dJ430N8.1 [Homo...	Homo sapiens
XP_001494692	94.9	similar to MORC...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D50926	7.6e-06	25.0	KIAA0136

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003594 9 89 PF02518 ATP-binding region

IPR011124 479 528 PF07496 Zinc finger

ProfileScan IPR011124 475 529 PS51050 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003594	9	89	PF02518	ATP-binding region
IPR011124	479	528	PF07496	Zinc finger
ProfileScan	IPR011124	475	529	PS51050	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGCAATTCCTACCAGAGCCGT

Primer_r
: TTGATGTCTATGTCCTCCTGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 22

Experimental conditions

Panel name	: CCR
Primer_f	: GATGATGAGCTGGACGCCTAC
Primer_r	: ATGTCCCGTGTAAGTCAAACC
PCR product length	: 167 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	190 bp
Genome contig ID	gi89161203r_29552600
PolyA signal sequence (TATAAA,-23)	+--------+--------+----*----+---- CTTCCTTAAGTTTATAAATATTTATTTTTTAAAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGATGCTGTGCCTGTGAGACCATACTTTTTTTTTTTTTTTTTTTTTTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	22	r	29652600	29694187	27	99.9	Perfect prediction

Primer_f	: TGCAATTCCTACCAGAGCCGT
Primer_r	: TTGATGTCTATGTCCTCCTGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0852

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information