HUGE |
Gene/Protein Characteristic Table for KIAA0852 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01128 |
---|---|
Accession No. : | AB020659 |
Description : | MORC family CW-type zinc finger protein 2. |
HUGO Gene Name : | MORC family CW-type zinc finger 2 (MORC2) |
Clone Name : | hk06101 [Vector Info] |
Flexi ORF Clone : | pF1KA0852
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4467 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 190 bp Genome contig ID gi89161203r_29552600 PolyA signal sequence
(TATAAA,-23) +----*----+----*----+----*----+----
CTTCCTTAAGTTTATAAATATTTATTTTTTAAAAGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAGATGCTGTGCCTGTGAGACCATACTTTTTTTTTTTTTTTTTTTTTTTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 22 r 29652600 29694187 27 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1017 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TGCAATTCCTACCAGAGCCGT | |
: TTGATGTCTATGTCCTCCTGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 22 |
: CCR | |
: GATGATGAGCTGGACGCCTAC | |
: ATGTCCCGTGTAAGTCAAACC | |
: 167 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |