HUGE

Gene/Protein Characteristic Table for KIAA0149

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00429
Accession No. :	D63483
Description :	Endothelial cells scavenger receptor precursor.
HUGO Gene Name :	scavenger receptor class F, member 1 (SCARF1)
Clone Name :	ha01221 [Vector Info]
Flexi ORF Clone :	pF1KSDA0149
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 3387 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 892 bp

Genome contig ID gi51511734r_1383937
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
CTTTGTTAAAAAAATAAAAAGTACTAACATTACAG
Flanking genome sequence
(99972 - 99923)
----+----*----+----*----+----*----+----*----+----*
ACATGTATAAAGTAAAACGGAGATTTCCTTTCTCCCCAGAGGCGTCTGTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 1483909 1495743 11 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 830 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q14162	0	99.9	Endothelial cel...	Homo sapiens
NP_003684	0	99.5	scavenger recep...	Homo sapiens
BAF84499	0	99.5	unnamed protein...	Homo sapiens
XP_853984	0	77.6	similar to scav...	Canis lupus fam...
EDM05225	6.3e-215	71.6	rCG35217 [Rattu...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058677	4.7e-25	36.0	KIAA1781
AB058676	1.9e-23	34.0	KIAA1780
AB011539	2.5e-18	37.4	KIAA0815
AB067494	5e-11	31.9	KIAA1907
AB040888	1.9e-08	31.5	KIAA1455

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002049 111 129 PR00011 EGF-like

IPR002049 172 190 PR00011 EGF-like

IPR002049 230 248 PR00011 EGF-like

HMMPfam IPR013111 57 86 PF07974 EGF

IPR002049 103 130 PF00053 EGF-like

IPR002049 163 190 PF00053 EGF-like

HMMSmart IPR006210 51 87 SM00181 EGF

IPR006210 98 130 SM00181 EGF

IPR006210 132 160 SM00181 EGF

IPR006210 162 191 SM00181 EGF

IPR006210 195 220 SM00181 EGF

IPR006210 224 249 SM00181 EGF

IPR006210 260 294 SM00181 EGF

IPR006210 305 339 SM00181 EGF

IPR006210 350 395 SM00181 EGF

ProfileScan IPR000742 53 87 PS50026 EGF-like

IPR000742 95 130 PS50026 EGF-like

IPR000742 215 249 PS50026 EGF-like

ScanRegExp IPR013032 75 86 PS00022 EGF-like region

IPR013032 75 90 PS01186 EGF-like region

IPR013032 118 129 PS00022 EGF-like region

IPR013032 148 163 PS01186 EGF-like region

IPR013032 179 190 PS00022 EGF-like region

IPR013032 179 194 PS01186 EGF-like region

IPR013032 208 219 PS00022 EGF-like region

IPR013032 208 223 PS01186 EGF-like region

IPR013032 237 248 PS00022 EGF-like region

IPR013032 237 252 PS01186 EGF-like region

IPR013032 370 381 PS00022 EGF-like region

IPR013032 370 385 PS01186 EGF-like region

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002049	111	129	PR00011	EGF-like
IPR002049	172	190	PR00011	EGF-like
IPR002049	230	248	PR00011	EGF-like
HMMPfam	IPR013111	57	86	PF07974	EGF
IPR002049	103	130	PF00053	EGF-like
IPR002049	163	190	PF00053	EGF-like
HMMSmart	IPR006210	51	87	SM00181	EGF
IPR006210	98	130	SM00181	EGF
IPR006210	132	160	SM00181	EGF
IPR006210	162	191	SM00181	EGF
IPR006210	195	220	SM00181	EGF
IPR006210	224	249	SM00181	EGF
IPR006210	260	294	SM00181	EGF
IPR006210	305	339	SM00181	EGF
IPR006210	350	395	SM00181	EGF
ProfileScan	IPR000742	53	87	PS50026	EGF-like
IPR000742	95	130	PS50026	EGF-like
IPR000742	215	249	PS50026	EGF-like
ScanRegExp	IPR013032	75	86	PS00022	EGF-like region
IPR013032	75	90	PS01186	EGF-like region
IPR013032	118	129	PS00022	EGF-like region
IPR013032	148	163	PS01186	EGF-like region
IPR013032	179	190	PS00022	EGF-like region
IPR013032	179	194	PS01186	EGF-like region
IPR013032	208	219	PS00022	EGF-like region
IPR013032	208	223	PS01186	EGF-like region
IPR013032	237	248	PS00022	EGF-like region
IPR013032	237	252	PS01186	EGF-like region
IPR013032	370	381	PS00022	EGF-like region
IPR013032	370	385	PS01186	EGF-like region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 1 MGLGLLLPLLLLWTRGTQ 18 SECONDARY 18

2 423 LIVGSLVPLLLLFLGLACCACCC 445 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1	MGLGLLLPLLLLWTRGTQ	18	SECONDARY	18
2	423	LIVGSLVPLLLLFLGLACCACCC	445	PRIMARY	23

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: CAGAAGGATCAAGAATGCACC
Primer_r	: AGAATCCAGGCTTGCATCGAC
PCR product length	: 106 (0.3k) bp
PCR conditions	: 95 °C15 sec64 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	892 bp
Genome contig ID	gi51511734r_1383937
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- CTTTGTTAAAAAAATAAAAAGTACTAACATTACAG
Flanking genome sequence (99972 - 99923)	----+--------+--------+--------+--------+----* ACATGTATAAAGTAAAACGGAGATTTCCTTTCTCCCCAGAGGCGTCTGTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	1483909	1495743	11	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0149

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information