HUGE

Gene/Protein Characteristic Table for KIAA1455

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05661
Accession No. :	AB040888
Description :
HUGO Gene Name :	odz, odd Oz/ten-m homolog 3 (Drosophila) (ODZ3)
Clone Name :	ef02451 [Vector Info]
Source :
Note :	We replaced fh16070, former representative clones for KIAA1455 with ef02451. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 7698 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 328 bp

Genome contig ID gi89161207f_183686796
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TCTGTTCCTTCTAGGCACTGTATTTAACTAACTTT
Flanking genome sequence
(272032 - 272081)
----+----*----+----*----+----*----+----*----+----*
AAAAAAGAAAAAAAAATGTGTACAGTGTTTCCAAATAGTCCCGAATTGTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 f 183762710 183958826 25 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 2450 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P273	100.0	Teneurin-3; Sho...	Homo sapiens
XP_001160536	99.8	similar to Ten-...	Pan troglodytes
XP_001091761	99.6	similar to odd ...	Macaca mulatta
XP_870167	98.9	similar to Tene...	Bos taurus
XP_001492464	98.9	similar to Tene...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032953	0	70.7	KIAA1127
AB037723	0	70.2	KIAA1302
D63483	1.2e-18	31.9	KIAA0149
AB058677	4.6e-17	29.8	KIAA1781
AB058676	5.6e-16	30.9	KIAA1780

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR009471 2 59 PF06484 Teneurin intracellular

IPR013111 269 295 PF07974 EGF

IPR013111 333 360 PF07974 EGF

IPR006209 365 392 PF00008 EGF-like

IPR013111 432 458 PF07974 EGF

IPR013111 463 489 PF07974 EGF

IPR006209 494 524 PF00008 EGF-like

IPR001258 923 951 PF01436 NHL repeat

IPR001258 970 989 PF01436 NHL repeat

IPR001258 1034 1059 PF01436 NHL repeat

IPR001258 1093 1119 PF01436 NHL repeat

IPR001258 1153 1180 PF01436 NHL repeat

IPR001258 1222 1249 PF01436 NHL repeat

IPR006530 1298 1335 PF05593 YD repeat

IPR006530 1361 1399 PF05593 YD repeat

IPR006530 1574 1610 PF05593 YD repeat

IPR006530 1904 1942 PF05593 YD repeat

IPR006530 1958 1996 PF05593 YD repeat

HMMSmart IPR006210 268 296 SM00181 EGF

IPR006210 299 327 SM00181 EGF

IPR006210 332 361 SM00181 EGF

IPR006210 364 393 SM00181 EGF

IPR006210 398 428 SM00181 EGF

IPR006210 431 459 SM00181 EGF

IPR006210 462 490 SM00181 EGF

IPR006210 493 525 SM00181 EGF

HMMTigr IPR006530 1298 1339 TIGR01643 YD repeat

IPR006530 1362 1403 TIGR01643 YD repeat

IPR006530 1574 1614 TIGR01643 YD repeat

IPR006530 1883 1924 TIGR01643 YD repeat

IPR006530 1958 2000 TIGR01643 YD repeat

ProfileScan IPR000742 265 296 PS50026 EGF-like

IPR000742 361 393 PS50026 EGF-like

IPR000742 395 428 PS50026 EGF-like

IPR000742 490 525 PS50026 EGF-like

ScanRegExp IPR013032 284 295 PS00022 EGF-like region

IPR013032 284 295 PS01186 EGF-like region

IPR013032 315 326 PS00022 EGF-like region

IPR013032 315 326 PS01186 EGF-like region

IPR013032 349 360 PS00022 EGF-like region

IPR013032 349 360 PS01186 EGF-like region

IPR013032 381 392 PS00022 EGF-like region

IPR013032 381 392 PS01186 EGF-like region

IPR013032 416 427 PS00022 EGF-like region

IPR013032 447 458 PS00022 EGF-like region

IPR013032 447 458 PS01186 EGF-like region

IPR013032 478 489 PS00022 EGF-like region

IPR013032 478 489 PS01186 EGF-like region

IPR013032 513 524 PS00022 EGF-like region

IPR013032 513 524 PS01186 EGF-like region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009471	2	59	PF06484	Teneurin intracellular
IPR013111	269	295	PF07974	EGF
IPR013111	333	360	PF07974	EGF
IPR006209	365	392	PF00008	EGF-like
IPR013111	432	458	PF07974	EGF
IPR013111	463	489	PF07974	EGF
IPR006209	494	524	PF00008	EGF-like
IPR001258	923	951	PF01436	NHL repeat
IPR001258	970	989	PF01436	NHL repeat
IPR001258	1034	1059	PF01436	NHL repeat
IPR001258	1093	1119	PF01436	NHL repeat
IPR001258	1153	1180	PF01436	NHL repeat
IPR001258	1222	1249	PF01436	NHL repeat
IPR006530	1298	1335	PF05593	YD repeat
IPR006530	1361	1399	PF05593	YD repeat
IPR006530	1574	1610	PF05593	YD repeat
IPR006530	1904	1942	PF05593	YD repeat
IPR006530	1958	1996	PF05593	YD repeat
HMMSmart	IPR006210	268	296	SM00181	EGF
IPR006210	299	327	SM00181	EGF
IPR006210	332	361	SM00181	EGF
IPR006210	364	393	SM00181	EGF
IPR006210	398	428	SM00181	EGF
IPR006210	431	459	SM00181	EGF
IPR006210	462	490	SM00181	EGF
IPR006210	493	525	SM00181	EGF
HMMTigr	IPR006530	1298	1339	TIGR01643	YD repeat
IPR006530	1362	1403	TIGR01643	YD repeat
IPR006530	1574	1614	TIGR01643	YD repeat
IPR006530	1883	1924	TIGR01643	YD repeat
IPR006530	1958	2000	TIGR01643	YD repeat
ProfileScan	IPR000742	265	296	PS50026	EGF-like
IPR000742	361	393	PS50026	EGF-like
IPR000742	395	428	PS50026	EGF-like
IPR000742	490	525	PS50026	EGF-like
ScanRegExp	IPR013032	284	295	PS00022	EGF-like region
IPR013032	284	295	PS01186	EGF-like region
IPR013032	315	326	PS00022	EGF-like region
IPR013032	315	326	PS01186	EGF-like region
IPR013032	349	360	PS00022	EGF-like region
IPR013032	349	360	PS01186	EGF-like region
IPR013032	381	392	PS00022	EGF-like region
IPR013032	381	392	PS01186	EGF-like region
IPR013032	416	427	PS00022	EGF-like region
IPR013032	447	458	PS00022	EGF-like region
IPR013032	447	458	PS01186	EGF-like region
IPR013032	478	489	PS00022	EGF-like region
IPR013032	478	489	PS01186	EGF-like region
IPR013032	513	524	PS00022	EGF-like region
IPR013032	513	524	PS01186	EGF-like region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 63 LCAVGVSVLLAILLSYFIAMHLF 85 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	63	LCAVGVSVLLAILLSYFIAMHLF	85	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AATGGCAGTTGATAAGAATGG

Primer_r
: TGGTGTCACAAGTTAAAGGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AATGGCAGTTGATAAGAATGG
Primer_r	: TGGTGTCACAAGTTAAAGGTC
PCR product length	: 137 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	328 bp
Genome contig ID	gi89161207f_183686796
PolyA signal sequence (None)	+--------+--------+----*----+---- TCTGTTCCTTCTAGGCACTGTATTTAACTAACTTT
Flanking genome sequence (272032 - 272081)	----+--------+--------+--------+--------+----* AAAAAAGAAAAAAAAATGTGTACAGTGTTTCCAAATAGTCCCGAATTGTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	f	183762710	183958826	25	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA1455

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information