HUGE

Gene/Protein Characteristic Table for KIAA1127

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06219
Accession No. :	AB032953
Description :	Teneurin-2.
HUGO Gene Name :	odz, odd Oz/ten-m homolog 2 (Drosophila) (ODZ2)
Clone Name :	bf00005 [Vector Info]
Source :	Human adult brain
Note :	We replaced hg02791, former representative clones for KIAA1127 with bf00005. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 7781 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1346 bp

Genome contig ID gi51511721f_167377952
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
TTTATACATAAATAAAGTCTCTAAAACTCCTGTGG
Flanking genome sequence
(245789 - 245838)
----+----*----+----*----+----*----+----*----+----*
ACACTGGTCTTGTGTGGAAATGATTTGAGATGAGAAAAAGGCAAGCGTTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 167477952 167623739 20 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 2144 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9NT68	100.0	Teneurin-2; Sho...	Homo sapiens
EAW61511	100.0	hCG38403, isofo...	Homo sapiens
EAW61512	100.0	hCG38403, isofo...	Homo sapiens
XP_001090928	99.6	similar to odd ...	Macaca mulatta
XP_001090700	99.6	similar to odd ...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040888	0	70.8	KIAA1455
AB037723	0	66.5	KIAA1302
D63483	1e-17	32.0	KIAA0149
AB011541	2.5e-10	46.6	KIAA0817
AB011539	3.1e-09	30.5	KIAA0815

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013111 10 37 PF07974 EGF

IPR013111 42 69 PF07974 EGF

IPR013111 76 104 PF07974 EGF

IPR013111 109 135 PF07974 EGF

IPR006209 140 166 PF00008 EGF-like

IPR006209 180 210 PF00008 EGF-like

IPR001258 607 633 PF01436 NHL repeat

IPR001258 652 683 PF01436 NHL repeat

IPR001258 725 750 PF01436 NHL repeat

IPR001258 784 819 PF01436 NHL repeat

IPR001258 844 871 PF01436 NHL repeat

IPR001258 913 940 PF01436 NHL repeat

IPR006530 1052 1090 PF05593 YD repeat

IPR006530 1370 1406 PF05593 YD repeat

IPR006530 1575 1611 PF05593 YD repeat

IPR006530 1650 1688 PF05593 YD repeat

HMMSmart IPR006210 2 38 SM00181 EGF

IPR001881 39 70 SM00179 EGF-like calcium-binding

IPR006210 41 70 SM00181 EGF

IPR006210 75 105 SM00181 EGF

IPR006210 108 136 SM00181 EGF

IPR006210 139 167 SM00181 EGF

IPR001881 176 211 SM00179 EGF-like calcium-binding

IPR006210 179 211 SM00181 EGF

HMMTigr IPR006530 989 1030 TIGR01643 YD repeat

IPR006530 1053 1094 TIGR01643 YD repeat

IPR006530 1265 1305 TIGR01643 YD repeat

IPR006530 1549 1595 TIGR01643 YD repeat

IPR006530 1650 1692 TIGR01643 YD repeat

ProfileScan IPR000742 6 38 PS50026 EGF-like

IPR000742 72 105 PS50026 EGF-like

IPR000742 136 167 PS50026 EGF-like

IPR000742 176 211 PS50026 EGF-like

ScanRegExp IPR013032 26 37 PS00022 EGF-like region

IPR013032 26 37 PS01186 EGF-like region

IPR013032 58 69 PS00022 EGF-like region

IPR013032 58 69 PS01186 EGF-like region

IPR013032 93 104 PS00022 EGF-like region

IPR013032 124 135 PS00022 EGF-like region

IPR013032 124 135 PS01186 EGF-like region

IPR013032 155 166 PS00022 EGF-like region

IPR013032 155 166 PS01186 EGF-like region

IPR013032 199 210 PS00022 EGF-like region

IPR013032 199 210 PS01186 EGF-like region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013111	10	37	PF07974	EGF
IPR013111	42	69	PF07974	EGF
IPR013111	76	104	PF07974	EGF
IPR013111	109	135	PF07974	EGF
IPR006209	140	166	PF00008	EGF-like
IPR006209	180	210	PF00008	EGF-like
IPR001258	607	633	PF01436	NHL repeat
IPR001258	652	683	PF01436	NHL repeat
IPR001258	725	750	PF01436	NHL repeat
IPR001258	784	819	PF01436	NHL repeat
IPR001258	844	871	PF01436	NHL repeat
IPR001258	913	940	PF01436	NHL repeat
IPR006530	1052	1090	PF05593	YD repeat
IPR006530	1370	1406	PF05593	YD repeat
IPR006530	1575	1611	PF05593	YD repeat
IPR006530	1650	1688	PF05593	YD repeat
HMMSmart	IPR006210	2	38	SM00181	EGF
IPR001881	39	70	SM00179	EGF-like calcium-binding
IPR006210	41	70	SM00181	EGF
IPR006210	75	105	SM00181	EGF
IPR006210	108	136	SM00181	EGF
IPR006210	139	167	SM00181	EGF
IPR001881	176	211	SM00179	EGF-like calcium-binding
IPR006210	179	211	SM00181	EGF
HMMTigr	IPR006530	989	1030	TIGR01643	YD repeat
IPR006530	1053	1094	TIGR01643	YD repeat
IPR006530	1265	1305	TIGR01643	YD repeat
IPR006530	1549	1595	TIGR01643	YD repeat
IPR006530	1650	1692	TIGR01643	YD repeat
ProfileScan	IPR000742	6	38	PS50026	EGF-like
IPR000742	72	105	PS50026	EGF-like
IPR000742	136	167	PS50026	EGF-like
IPR000742	176	211	PS50026	EGF-like
ScanRegExp	IPR013032	26	37	PS00022	EGF-like region
IPR013032	26	37	PS01186	EGF-like region
IPR013032	58	69	PS00022	EGF-like region
IPR013032	58	69	PS01186	EGF-like region
IPR013032	93	104	PS00022	EGF-like region
IPR013032	124	135	PS00022	EGF-like region
IPR013032	124	135	PS01186	EGF-like region
IPR013032	155	166	PS00022	EGF-like region
IPR013032	155	166	PS01186	EGF-like region
IPR013032	199	210	PS00022	EGF-like region
IPR013032	199	210	PS01186	EGF-like region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CGACTTTGGGGGTGATTTGTG

Primer_r
: TGGGACCTGAGAGTTAAGTGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTGTTTAGATTCCGTAGTTCG
Primer_r	: CCTTTCGGCTCATGTATGTAC
PCR product length	: 112 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1346 bp
Genome contig ID	gi51511721f_167377952
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TTTATACATAAATAAAGTCTCTAAAACTCCTGTGG
Flanking genome sequence (245789 - 245838)	----+--------+--------+--------+--------+----* ACACTGGTCTTGTGTGGAAATGATTTGAGATGAGAAAAAGGCAAGCGTTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	167477952	167623739	20	99.5	Perfect prediction

Primer_f	: CGACTTTGGGGGTGATTTGTG
Primer_r	: TGGGACCTGAGAGTTAAGTGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1127

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information