HUGE

Gene/Protein Characteristic Table for KIAA0817

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK00645
Accession No. :	AB011541
Description :	Multiple epidermal growth factor-like domains 8.
HUGO Gene Name :
Clone Name :	hg01392s2 [Vector Info]
Flexi ORF Clone :	pF1KSDA0817
Source :	Human adult brain
Note :	We replaced hg01392, former representative clones for KIAA0817 with hg01392s2. (1998/8/22)

Features of the cloned DNA sequence	Description

Length: 9984 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1012 bp

Genome contig ID gi42406306f_47421601
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTCCAACCTGGGTGACAGAGCGAGACTCCACCTC
Flanking genome sequence
(152179 - 152228)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAATTTAAGAGGTCACTCAGTTGTGCTGTGGAGAATG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 47521601 47573778 41 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 2785 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAA32469	100.0	MEGF8 [Homo sap...	Homo sapiens
AAI53881	100.0	Multiple EGF-li...	Homo sapiens
XP_194337	94.4	multiple EGF-li...	Mus musculus
AAP35084	97.2	EGF domain-cont...	Homo sapiens
Q7Z7M0	97.6	Multiple epider...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011106	2.6e-07	22.4	KIAA0534
AB053450	1e-05	22.4	KIAA1776

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000859 57 144 PF00431 CUB

IPR013111 181 209 PF07974 EGF

IPR006652 285 332 PF01344 Kelch repeat type 1

IPR006652 454 505 PF01344 Kelch repeat type 1

IPR002165 889 944 PF01437 Plexin

IPR002165 945 1013 PF01437 Plexin

IPR013091 1014 1054 PF07645 EGF calcium-binding

IPR002049 1103 1148 PF00053 EGF-like

IPR002049 1151 1199 PF00053 EGF-like

IPR006652 1505 1553 PF01344 Kelch repeat type 1

IPR006652 1611 1662 PF01344 Kelch repeat type 1

IPR006652 1724 1763 PF01344 Kelch repeat type 1

IPR002049 2209 2242 PF00053 EGF-like

HMMSmart IPR000859 40 147 SM00042 CUB

IPR006210 148 177 SM00181 EGF

IPR006210 180 210 SM00181 EGF

IPR003659 568 620 SM00423 Plexin/semaphorin/integrin

IPR003659 787 839 SM00423 Plexin/semaphorin/integrin

IPR003659 840 887 SM00423 Plexin/semaphorin/integrin

IPR003659 889 931 SM00423 Plexin/semaphorin/integrin

IPR003659 945 1013 SM00423 Plexin/semaphorin/integrin

IPR001881 1014 1055 SM00179 EGF-like calcium-binding

IPR006210 1017 1055 SM00181 EGF

IPR006210 1057 1100 SM00181 EGF

IPR002049 1103 1148 SM00180 EGF-like

IPR006210 1110 1149 SM00181 EGF

IPR006210 1150 1200 SM00181 EGF

IPR002049 1151 1199 SM00180 EGF-like

IPR006210 1346 1385 SM00181 EGF

IPR006210 1388 1421 SM00181 EGF

IPR003659 1816 1856 SM00423 Plexin/semaphorin/integrin

IPR003659 1864 1919 SM00423 Plexin/semaphorin/integrin

IPR003659 2000 2058 SM00423 Plexin/semaphorin/integrin

IPR003659 2060 2117 SM00423 Plexin/semaphorin/integrin

IPR001881 2118 2160 SM00179 EGF-like calcium-binding

IPR006210 2121 2160 SM00181 EGF

IPR006210 2162 2190 SM00181 EGF

IPR002049 2178 2239 SM00180 EGF-like

IPR006210 2200 2240 SM00181 EGF

IPR006210 2241 2304 SM00181 EGF

IPR002049 2244 2317 SM00180 EGF-like

IPR006210 2328 2382 SM00181 EGF

ProfileScan IPR000859 37 147 PS01180 CUB

IPR000742 177 210 PS50026 EGF-like

IPR000742 1014 1055 PS50026 EGF-like

IPR002049 1103 1150 PS50027 EGF-like

IPR002049 1151 1201 PS50027 EGF-like

IPR000859 1203 1345 PS01180 CUB

IPR000742 1343 1385 PS50026 EGF-like

IPR000742 2118 2156 PS50026 EGF-like

IPR002049 2193 2241 PS50027 EGF-like

IPR002049 2320 2383 PS50027 EGF-like

ScanRegExp IPR013032 165 176 PS00022 EGF-like region

IPR013032 165 176 PS01186 EGF-like region

IPR013032 198 209 PS00022 EGF-like region

IPR013032 198 209 PS01186 EGF-like region

IPR001304 788 812 PS00615 C-type lectin

IPR001881 1014 1040 PS01187 EGF-like calcium-binding

IPR000152 1031 1042 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 1040 1054 PS01186 EGF-like region

IPR002049 1119 1153 PS01248 EGF-like

IPR013032 1171 1182 PS00022 EGF-like region

IPR002049 1171 1203 PS01248 EGF-like

IPR013032 1373 1384 PS00022 EGF-like region

IPR013032 1373 1384 PS01186 EGF-like region

IPR013032 1409 1420 PS00022 EGF-like region

IPR013032 1409 1420 PS01186 EGF-like region

IPR000152 2135 2146 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 2144 2159 PS01186 EGF-like region

IPR013032 2178 2189 PS00022 EGF-like region

IPR013032 2178 2193 PS01186 EGF-like region

IPR002049 2210 2242 PS01248 EGF-like

IPR002049 2291 2322 PS01248 EGF-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000859	57	144	PF00431	CUB
IPR013111	181	209	PF07974	EGF
IPR006652	285	332	PF01344	Kelch repeat type 1
IPR006652	454	505	PF01344	Kelch repeat type 1
IPR002165	889	944	PF01437	Plexin
IPR002165	945	1013	PF01437	Plexin
IPR013091	1014	1054	PF07645	EGF calcium-binding
IPR002049	1103	1148	PF00053	EGF-like
IPR002049	1151	1199	PF00053	EGF-like
IPR006652	1505	1553	PF01344	Kelch repeat type 1
IPR006652	1611	1662	PF01344	Kelch repeat type 1
IPR006652	1724	1763	PF01344	Kelch repeat type 1
IPR002049	2209	2242	PF00053	EGF-like
HMMSmart	IPR000859	40	147	SM00042	CUB
IPR006210	148	177	SM00181	EGF
IPR006210	180	210	SM00181	EGF
IPR003659	568	620	SM00423	Plexin/semaphorin/integrin
IPR003659	787	839	SM00423	Plexin/semaphorin/integrin
IPR003659	840	887	SM00423	Plexin/semaphorin/integrin
IPR003659	889	931	SM00423	Plexin/semaphorin/integrin
IPR003659	945	1013	SM00423	Plexin/semaphorin/integrin
IPR001881	1014	1055	SM00179	EGF-like calcium-binding
IPR006210	1017	1055	SM00181	EGF
IPR006210	1057	1100	SM00181	EGF
IPR002049	1103	1148	SM00180	EGF-like
IPR006210	1110	1149	SM00181	EGF
IPR006210	1150	1200	SM00181	EGF
IPR002049	1151	1199	SM00180	EGF-like
IPR006210	1346	1385	SM00181	EGF
IPR006210	1388	1421	SM00181	EGF
IPR003659	1816	1856	SM00423	Plexin/semaphorin/integrin
IPR003659	1864	1919	SM00423	Plexin/semaphorin/integrin
IPR003659	2000	2058	SM00423	Plexin/semaphorin/integrin
IPR003659	2060	2117	SM00423	Plexin/semaphorin/integrin
IPR001881	2118	2160	SM00179	EGF-like calcium-binding
IPR006210	2121	2160	SM00181	EGF
IPR006210	2162	2190	SM00181	EGF
IPR002049	2178	2239	SM00180	EGF-like
IPR006210	2200	2240	SM00181	EGF
IPR006210	2241	2304	SM00181	EGF
IPR002049	2244	2317	SM00180	EGF-like
IPR006210	2328	2382	SM00181	EGF
ProfileScan	IPR000859	37	147	PS01180	CUB
IPR000742	177	210	PS50026	EGF-like
IPR000742	1014	1055	PS50026	EGF-like
IPR002049	1103	1150	PS50027	EGF-like
IPR002049	1151	1201	PS50027	EGF-like
IPR000859	1203	1345	PS01180	CUB
IPR000742	1343	1385	PS50026	EGF-like
IPR000742	2118	2156	PS50026	EGF-like
IPR002049	2193	2241	PS50027	EGF-like
IPR002049	2320	2383	PS50027	EGF-like
ScanRegExp	IPR013032	165	176	PS00022	EGF-like region
IPR013032	165	176	PS01186	EGF-like region
IPR013032	198	209	PS00022	EGF-like region
IPR013032	198	209	PS01186	EGF-like region
IPR001304	788	812	PS00615	C-type lectin
IPR001881	1014	1040	PS01187	EGF-like calcium-binding
IPR000152	1031	1042	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	1040	1054	PS01186	EGF-like region
IPR002049	1119	1153	PS01248	EGF-like
IPR013032	1171	1182	PS00022	EGF-like region
IPR002049	1171	1203	PS01248	EGF-like
IPR013032	1373	1384	PS00022	EGF-like region
IPR013032	1373	1384	PS01186	EGF-like region
IPR013032	1409	1420	PS00022	EGF-like region
IPR013032	1409	1420	PS01186	EGF-like region
IPR000152	2135	2146	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	2144	2159	PS01186	EGF-like region
IPR013032	2178	2189	PS00022	EGF-like region
IPR013032	2178	2193	PS01186	EGF-like region
IPR002049	2210	2242	PS01248	EGF-like
IPR002049	2291	2322	PS01248	EGF-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 8 MALGKVLAMALVLALAVLGSLSP 30 PRIMARY 23

2 2588 LFVFFSVFFSCFFLFLSLCVLLW 2610 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	8	MALGKVLAMALVLALAVLGSLSP	30	PRIMARY	23
2	2588	LFVFFSVFFSCFFLFLSLCVLLW	2610	PRIMARY	23

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: nakayama
Primer_f	: GATGGGGCCTCCTTTGTTCTG
Primer_r	: GTCTCTTGGTTCCTGCTTTGC
PCR product length	: 98 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1012 bp
Genome contig ID	gi42406306f_47421601
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAACCTGGGTGACAGAGCGAGACTCCACCTC
Flanking genome sequence (152179 - 152228)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAATTTAAGAGGTCACTCAGTTGTGCTGTGGAGAATG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	47521601	47573778	41	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA0817

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information