HUGE

Gene/Protein Characteristic Table for KIAA1302

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06220
Accession No. :	AB037723
Description :	Teneurin-4.
HUGO Gene Name :	odz, odd Oz/ten-m homolog 4 (Drosophila) (ODZ4)
Clone Name :	ff04539 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fg06864 and bf00104, former representative clones for KIAA1302 with ff04539. (2002/5/10,2005/08/06)

Features of the cloned DNA sequence	Description

Length: 10826 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4775 bp

Genome contig ID gi51511727r_77941977
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
AGCCTTCGTTGACAAATAAAGACTATTTTGTGTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACAGGTGTCTGGTGGCCTTTGCTTGGAGATAAAGGCTTCCTCTTGCCTGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 r 78041977 78175696 19 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 2016 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6N022	100.0	Teneurin-4; Sho...	Homo sapiens
XP_858706	98.5	similar to odd ...	Canis lupus fam...
XP_858664	98.5	similar to odd ...	Canis lupus fam...
XP_001494247	98.5	odz, odd Oz/ten...	Equus caballus
XP_218927	97.6	similar to odd ...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040888	0	70.2	KIAA1455
AB032953	0	66.5	KIAA1127
AB058677	2.5e-05	27.4	KIAA1781
AB058676	4.6e-05	29.4	KIAA1780
D63483	0.00028	30.9	KIAA0149

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013111 7 33 PF07974 EGF

IPR001258 476 502 PF01436 NHL repeat

IPR001258 594 619 PF01436 NHL repeat

IPR001258 653 688 PF01436 NHL repeat

IPR001258 714 741 PF01436 NHL repeat

IPR001258 783 810 PF01436 NHL repeat

IPR006530 859 896 PF05593 YD repeat

IPR006530 922 960 PF05593 YD repeat

IPR006530 1464 1498 PF05593 YD repeat

IPR006530 1518 1571 PF05593 YD repeat

HMMSmart IPR006210 6 34 SM00181 EGF

IPR006210 46 78 SM00181 EGF

HMMTigr IPR006530 859 900 TIGR01643 YD repeat

IPR006530 923 964 TIGR01643 YD repeat

IPR006530 1134 1174 TIGR01643 YD repeat

IPR006530 1443 1482 TIGR01643 YD repeat

IPR006530 1518 1560 TIGR01643 YD repeat

ProfileScan IPR000742 3 34 PS50026 EGF-like

IPR000742 43 78 PS50026 EGF-like

ScanRegExp IPR013032 22 33 PS00022 EGF-like region

IPR013032 22 33 PS01186 EGF-like region

IPR013032 66 77 PS00022 EGF-like region

IPR013032 66 77 PS01186 EGF-like region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013111	7	33	PF07974	EGF
IPR001258	476	502	PF01436	NHL repeat
IPR001258	594	619	PF01436	NHL repeat
IPR001258	653	688	PF01436	NHL repeat
IPR001258	714	741	PF01436	NHL repeat
IPR001258	783	810	PF01436	NHL repeat
IPR006530	859	896	PF05593	YD repeat
IPR006530	922	960	PF05593	YD repeat
IPR006530	1464	1498	PF05593	YD repeat
IPR006530	1518	1571	PF05593	YD repeat
HMMSmart	IPR006210	6	34	SM00181	EGF
IPR006210	46	78	SM00181	EGF
HMMTigr	IPR006530	859	900	TIGR01643	YD repeat
IPR006530	923	964	TIGR01643	YD repeat
IPR006530	1134	1174	TIGR01643	YD repeat
IPR006530	1443	1482	TIGR01643	YD repeat
IPR006530	1518	1560	TIGR01643	YD repeat
ProfileScan	IPR000742	3	34	PS50026	EGF-like
IPR000742	43	78	PS50026	EGF-like
ScanRegExp	IPR013032	22	33	PS00022	EGF-like region
IPR013032	22	33	PS01186	EGF-like region
IPR013032	66	77	PS00022	EGF-like region
IPR013032	66	77	PS01186	EGF-like region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CATTGCTGAGGTGATAGAGAG

Primer_r
: CCTTCCCACACTCTGATATTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4775 bp
Genome contig ID	gi51511727r_77941977
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AGCCTTCGTTGACAAATAAAGACTATTTTGTGTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACAGGTGTCTGGTGGCCTTTGCTTGGAGATAAAGGCTTCCTCTTGCCTGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	r	78041977	78175696	19	99.5	Perfect prediction

Primer_f	: CATTGCTGAGGTGATAGAGAG
Primer_r	: CCTTCCCACACTCTGATATTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1302

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information