HUGE

Gene/Protein Characteristic Table for KIAA1907

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05802
Accession No. :	AB067494
Description :	Laminin subunit alpha-5 precursor.
HUGO Gene Name :
Clone Name :	ah00504 [Vector Info]
Source :	Human brain (amygdala)

Features of the cloned DNA sequence	Description

Length: 5213 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 0 bp

Genome contig ID gi51511747r_60232531
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTTCGCCGAGGGCTGTGTCCTGCGAGGCGGCCGC
Flanking genome sequence
(99743 - 99694)
----+----*----+----*----+----*----+----*----+----*
ACCCAGTGCCTCTGCAAACCTGGTTATGCAGGTGCCTCCTGCGAGCGGTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 r 60332274 60360790 41 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1737 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAM12527	99.8	laminin alpha5 ...	Homo sapiens
CAC22310	99.8	laminin, alpha ...	Homo sapiens
NP_005551	99.8	laminin alpha 5...	Homo sapiens
EAW75374	99.7	laminin, alpha ...	Homo sapiens
O15230	99.7	Laminin subunit...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011539	2.1e-19	32.2	KIAA0815
AB058676	8.1e-18	29.6	KIAA1780
D63483	5.5e-15	31.9	KIAA0149
AB058760	4.7e-13	30.0	KIAA1857
AB011542	4.9e-11	33.9	KIAA0818

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000034 1413 1587 PD003031 Laminin B

FPrintScan IPR002049 492 510 PR00011 EGF-like

IPR002049 593 611 PR00011 EGF-like

IPR002049 1346 1364 PR00011 EGF-like

HMMPfam IPR008211 13 101 PF00055 Laminin

IPR002049 103 159 PF00053 EGF-like

IPR002049 162 229 PF00053 EGF-like

IPR002049 232 274 PF00053 EGF-like

IPR002049 297 341 PF00053 EGF-like

IPR002049 344 387 PF00053 EGF-like

IPR002049 390 432 PF00053 EGF-like

IPR002049 435 477 PF00053 EGF-like

IPR002049 480 528 PF00053 EGF-like

IPR002049 547 576 PF00053 EGF-like

IPR002049 579 629 PF00053 EGF-like

IPR002049 632 664 PF00053 EGF-like

IPR002049 1241 1289 PF00053 EGF-like

IPR002049 1331 1377 PF00053 EGF-like

IPR002049 1380 1428 PF00053 EGF-like

IPR000034 1496 1632 PF00052 Laminin B

IPR002049 1634 1664 PF00053 EGF-like

IPR002049 1667 1713 PF00053 EGF-like

HMMSmart IPR008211 1 101 SM00136 Laminin

IPR002049 103 159 SM00180 EGF-like

IPR006210 158 209 SM00181 EGF

IPR002049 162 229 SM00180 EGF-like

IPR006210 228 262 SM00181 EGF

IPR002049 232 274 SM00180 EGF-like

IPR002049 297 341 SM00180 EGF-like

IPR006210 308 342 SM00181 EGF

IPR006210 343 388 SM00181 EGF

IPR002049 344 387 SM00180 EGF-like

IPR002049 390 432 SM00180 EGF-like

IPR006210 391 433 SM00181 EGF

IPR002049 435 477 SM00180 EGF-like

IPR006210 436 478 SM00181 EGF

IPR002049 480 523 SM00180 EGF-like

IPR006210 481 524 SM00181 EGF

IPR002049 527 576 SM00180 EGF-like

IPR006210 527 580 SM00181 EGF

IPR002049 579 629 SM00180 EGF-like

IPR002049 632 676 SM00180 EGF-like

IPR002049 1241 1284 SM00180 EGF-like

IPR002049 1287 1328 SM00180 EGF-like

IPR006210 1330 1378 SM00181 EGF

IPR002049 1331 1377 SM00180 EGF-like

IPR002049 1380 1428 SM00180 EGF-like

IPR000034 1491 1621 SM00281 Laminin B

IPR006210 1666 1714 SM00181 EGF

IPR002049 1667 1713 SM00180 EGF-like

ProfileScan IPR008211 1 102 PS51117 Laminin

IPR002049 103 161 PS50027 EGF-like

IPR002049 162 231 PS50027 EGF-like

IPR002049 232 276 PS50027 EGF-like

IPR002049 297 343 PS50027 EGF-like

IPR002049 344 394 PS50027 EGF-like

IPR002049 396 434 PS50027 EGF-like

IPR002049 435 479 PS50027 EGF-like

IPR002049 480 530 PS50027 EGF-like

IPR002049 535 578 PS50027 EGF-like

IPR002049 579 631 PS50027 EGF-like

IPR002049 632 677 PS50027 EGF-like

IPR002049 1241 1286 PS50027 EGF-like

IPR002049 1287 1330 PS50027 EGF-like

IPR002049 1331 1379 PS50027 EGF-like

IPR002049 1380 1430 PS50027 EGF-like

IPR000034 1451 1633 PS51115 Laminin B

IPR001368 1647 1695 PS50050 TNFR/CD27/30/40/95 cysteine-rich region

IPR002049 1667 1715 PS50027 EGF-like

ScanRegExp IPR013032 125 136 PS00022 EGF-like region

IPR002049 125 159 PS01248 EGF-like

IPR002049 196 232 PS01248 EGF-like

IPR013032 250 261 PS00022 EGF-like region

IPR002049 250 274 PS01248 EGF-like

IPR013032 318 329 PS00022 EGF-like region

IPR002049 318 346 PS01248 EGF-like

IPR013032 363 374 PS00022 EGF-like region

IPR013032 363 377 PS01186 EGF-like region

IPR002049 363 392 PS01248 EGF-like

IPR013032 408 419 PS00022 EGF-like region

IPR002049 408 437 PS01248 EGF-like

IPR013032 453 464 PS00022 EGF-like region

IPR013032 453 467 PS01186 EGF-like region

IPR002049 453 482 PS01248 EGF-like

IPR013032 499 510 PS00022 EGF-like region

IPR002049 499 528 PS01248 EGF-like

IPR013032 547 558 PS00022 EGF-like region

IPR002049 547 581 PS01248 EGF-like

IPR013032 600 611 PS00022 EGF-like region

IPR002049 600 634 PS01248 EGF-like

IPR013032 651 662 PS00022 EGF-like region

IPR013032 1260 1271 PS00022 EGF-like region

IPR002049 1260 1294 PS01248 EGF-like

IPR013032 1353 1364 PS00022 EGF-like region

IPR002049 1353 1382 PS01248 EGF-like

IPR013032 1399 1410 PS00022 EGF-like region

IPR002049 1399 1433 PS01248 EGF-like

IPR013032 1634 1645 PS00022 EGF-like region

IPR002049 1634 1669 PS01248 EGF-like

IPR002049 1683 1718 PS01248 EGF-like

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000034	1413	1587	PD003031	Laminin B
FPrintScan	IPR002049	492	510	PR00011	EGF-like
IPR002049	593	611	PR00011	EGF-like
IPR002049	1346	1364	PR00011	EGF-like
HMMPfam	IPR008211	13	101	PF00055	Laminin
IPR002049	103	159	PF00053	EGF-like
IPR002049	162	229	PF00053	EGF-like
IPR002049	232	274	PF00053	EGF-like
IPR002049	297	341	PF00053	EGF-like
IPR002049	344	387	PF00053	EGF-like
IPR002049	390	432	PF00053	EGF-like
IPR002049	435	477	PF00053	EGF-like
IPR002049	480	528	PF00053	EGF-like
IPR002049	547	576	PF00053	EGF-like
IPR002049	579	629	PF00053	EGF-like
IPR002049	632	664	PF00053	EGF-like
IPR002049	1241	1289	PF00053	EGF-like
IPR002049	1331	1377	PF00053	EGF-like
IPR002049	1380	1428	PF00053	EGF-like
IPR000034	1496	1632	PF00052	Laminin B
IPR002049	1634	1664	PF00053	EGF-like
IPR002049	1667	1713	PF00053	EGF-like
HMMSmart	IPR008211	1	101	SM00136	Laminin
IPR002049	103	159	SM00180	EGF-like
IPR006210	158	209	SM00181	EGF
IPR002049	162	229	SM00180	EGF-like
IPR006210	228	262	SM00181	EGF
IPR002049	232	274	SM00180	EGF-like
IPR002049	297	341	SM00180	EGF-like
IPR006210	308	342	SM00181	EGF
IPR006210	343	388	SM00181	EGF
IPR002049	344	387	SM00180	EGF-like
IPR002049	390	432	SM00180	EGF-like
IPR006210	391	433	SM00181	EGF
IPR002049	435	477	SM00180	EGF-like
IPR006210	436	478	SM00181	EGF
IPR002049	480	523	SM00180	EGF-like
IPR006210	481	524	SM00181	EGF
IPR002049	527	576	SM00180	EGF-like
IPR006210	527	580	SM00181	EGF
IPR002049	579	629	SM00180	EGF-like
IPR002049	632	676	SM00180	EGF-like
IPR002049	1241	1284	SM00180	EGF-like
IPR002049	1287	1328	SM00180	EGF-like
IPR006210	1330	1378	SM00181	EGF
IPR002049	1331	1377	SM00180	EGF-like
IPR002049	1380	1428	SM00180	EGF-like
IPR000034	1491	1621	SM00281	Laminin B
IPR006210	1666	1714	SM00181	EGF
IPR002049	1667	1713	SM00180	EGF-like
ProfileScan	IPR008211	1	102	PS51117	Laminin
IPR002049	103	161	PS50027	EGF-like
IPR002049	162	231	PS50027	EGF-like
IPR002049	232	276	PS50027	EGF-like
IPR002049	297	343	PS50027	EGF-like
IPR002049	344	394	PS50027	EGF-like
IPR002049	396	434	PS50027	EGF-like
IPR002049	435	479	PS50027	EGF-like
IPR002049	480	530	PS50027	EGF-like
IPR002049	535	578	PS50027	EGF-like
IPR002049	579	631	PS50027	EGF-like
IPR002049	632	677	PS50027	EGF-like
IPR002049	1241	1286	PS50027	EGF-like
IPR002049	1287	1330	PS50027	EGF-like
IPR002049	1331	1379	PS50027	EGF-like
IPR002049	1380	1430	PS50027	EGF-like
IPR000034	1451	1633	PS51115	Laminin B
IPR001368	1647	1695	PS50050	TNFR/CD27/30/40/95 cysteine-rich region
IPR002049	1667	1715	PS50027	EGF-like
ScanRegExp	IPR013032	125	136	PS00022	EGF-like region
IPR002049	125	159	PS01248	EGF-like
IPR002049	196	232	PS01248	EGF-like
IPR013032	250	261	PS00022	EGF-like region
IPR002049	250	274	PS01248	EGF-like
IPR013032	318	329	PS00022	EGF-like region
IPR002049	318	346	PS01248	EGF-like
IPR013032	363	374	PS00022	EGF-like region
IPR013032	363	377	PS01186	EGF-like region
IPR002049	363	392	PS01248	EGF-like
IPR013032	408	419	PS00022	EGF-like region
IPR002049	408	437	PS01248	EGF-like
IPR013032	453	464	PS00022	EGF-like region
IPR013032	453	467	PS01186	EGF-like region
IPR002049	453	482	PS01248	EGF-like
IPR013032	499	510	PS00022	EGF-like region
IPR002049	499	528	PS01248	EGF-like
IPR013032	547	558	PS00022	EGF-like region
IPR002049	547	581	PS01248	EGF-like
IPR013032	600	611	PS00022	EGF-like region
IPR002049	600	634	PS01248	EGF-like
IPR013032	651	662	PS00022	EGF-like region
IPR013032	1260	1271	PS00022	EGF-like region
IPR002049	1260	1294	PS01248	EGF-like
IPR013032	1353	1364	PS00022	EGF-like region
IPR002049	1353	1382	PS01248	EGF-like
IPR013032	1399	1410	PS00022	EGF-like region
IPR002049	1399	1433	PS01248	EGF-like
IPR013032	1634	1645	PS00022	EGF-like region
IPR002049	1634	1669	PS01248	EGF-like
IPR002049	1683	1718	PS01248	EGF-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCTACTGTAAGGAGAACGTGC

Primer_r
: CTCCATATCCACGAACTCCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	0 bp
Genome contig ID	gi51511747r_60232531
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTTCGCCGAGGGCTGTGTCCTGCGAGGCGGCCGC
Flanking genome sequence (99743 - 99694)	----+--------+--------+--------+--------+----* ACCCAGTGCCTCTGCAAACCTGGTTATGCAGGTGCCTCCTGCGAGCGGTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	r	60332274	60360790	41	99.9	Perfect prediction

Primer_f	: GCTACTGTAAGGAGAACGTGC
Primer_r	: CTCCATATCCACGAACTCCTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1907

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information