HUGE |
Gene/Protein Characteristic Table for KIAA1857 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00933 |
---|---|
Accession No. : | AB058760 |
Description : | Netrin-G2 precursor. |
HUGO Gene Name : | netrin G2 (NTNG2) |
Clone Name : | fk03350 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1857
![]() |
Source : | Human fetal brain |
Note : | We replaced fh05673, former representative clones for KIAA1857 with fk03350. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3083 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 714 bp Genome contig ID gi89161216f_133927314 PolyA signal sequence
(AGTAAA,-16) +----*----+----*----+----*----+----
GATGGTGGAGAATCCGAGGAGTAAAGAGTTTGCTCFlanking genome sequence
(180720 - 180769) ----+----*----+----*----+----*----+----*----+----*
ACTGCTGCCTCCACGGCCTGTTTTCTTTCTGTGTTGGGGACGGTGGGCAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 9 f 134027155 134108032 7 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 549 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AAGACCTGGATTGATTGGAAG | |
: ATGGACAGATCAGAAAGTTGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 9 |
: GeneBridge 4 | |
: TCTGCTCTCACCTGGACTCAC | |
: TGGTCATCGTCTTCCTGGTGC | |
: 95 bp | |
: 15 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |