HUGE |
Gene/Protein Characteristic Table for KIAA0818 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK05967 |
---|---|
Accession No. : | AB011542 |
Description : | Multiple epidermal growth factor-like domains 9 precursor. |
HUGO Gene Name : | |
Clone Name : | hj00220 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5507 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 4377 bp Genome contig ID gi89161216r_122302912 PolyA signal sequence
(CATAAA,-21) +----*----+----*----+----*----+----
CTTTCAGCCCACTTCATAAAAATCTTTGAACTCTTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
CATTTATTGGCCATGTATTTTGTTTAAGTTCATTTAAAGAATGTTTTCTA
Chr f/r start end exon identity class ContigView(URL based/DAS) 9 r 122402912 122461596 5 99.1 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 375 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 9 |
: nakayama | |
: ACATGAAACAACTCTGACCAC | |
: TTATAGGCCGAGCAATTAGGG | |
: 264 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |