| HUGE |
Gene/Protein Characteristic Table for KIAA0178 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK01055 |
|---|---|
| Accession No. : | D80000 |
| Description : | Structural maintenance of chromosomes protein 1A. |
| HUGO Gene Name : | structural maintenance of chromosomes 1A (SMC1A) |
| Clone Name : | ha02501s1 [Vector Info] |
| Flexi ORF Clone : | pF1KA0178
|
| Source : | Myeloblast cell line (KG-1) |
| Note : | We replaced ha02501, former representative clones for KIAA0178 with ha02501s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5825 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2123 bp Genome contig ID gi89161218r_53321626 PolyA signal sequence
(ATTAAA,-24)
TTCTAATACATATTAAAAGACATAACTATCAAAACFlanking genome sequence
(100000 - 99951)
AAAATAAATTTGTCTGTTTTCAACCAAAGAAGTCACGTACCACTGGTGGT
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1233 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : X |
| : Genebridge 4 | |
| : AATACTACACAGGAGCATCAC | |
| : AGACCTCAGATCAACCTCAAG | |
| : 184 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
