HUGE

Gene/Protein Characteristic Table for KIAA0182

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05365
Accession No. :	D80004
Description :	Genetic suppressor element 1.
HUGO Gene Name :
Clone Name :	ha02329s1 [Vector Info]
Flexi ORF Clone :	pF1KA0182
Source :	Myeloblast cell line (KG-1)
Note :	We replaced ha02329, former representative clones for KIAA0182 with ha02329s1. (2008/8/27)

Features of the cloned DNA sequence	Description

Length: 7133 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3658 bp

Genome contig ID gi51511732f_84104459
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
AACATCCAAAAAATAAAATCTTCCTAAATTATGTT
Flanking genome sequence
(162854 - 162903)
----+----*----+----*----+----*----+----*----+----*
AAGAGGAAAATCTTTTTTATGATATAAAACAAAGCCAAACAAAGAAAAGC

Features of the protein sequence	Description

Length: 1157 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_511150	98.2	hypothetical pr...	Pan troglodytes
XP_001082386	97.8	similar to gene...	Macaca mulatta
NP_001127945	99.9	genetic suppres...	Homo sapiens
AAH43094	89.5	Genetic suppres...	Mus musculus
Q3U3C9	89.5	Genetic suppres...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020660	0.00064	22.7	KIAA0853

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: CAAGATGGAGATGGTCAGCAC
Primer_r	: TAGCATGGTCTTCCTCAGGTC
PCR product length	: 199 bp
PCR conditions	: 95 °C15 sec68 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3658 bp
Genome contig ID	gi51511732f_84104459
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- AACATCCAAAAAATAAAATCTTCCTAAATTATGTT
Flanking genome sequence (162854 - 162903)	----+--------+--------+--------+--------+----* AAGAGGAAAATCTTTTTTATGATATAAAACAAAGCCAAACAAAGAAAAGC

Gene/Protein Characteristic Table for KIAA0182

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information