HUGE |
Gene/Protein Characteristic Table for KIAA0182 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05365 |
---|---|
Accession No. : | D80004 |
Description : | Genetic suppressor element 1. |
HUGO Gene Name : | |
Clone Name : | ha02329s1 [Vector Info] |
Flexi ORF Clone : | pF1KA0182
![]() |
Source : | Myeloblast cell line (KG-1) |
Note : | We replaced ha02329, former representative clones for KIAA0182 with ha02329s1. (2008/8/27) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7133 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3658 bp Genome contig ID gi51511732f_84104459 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
AACATCCAAAAAATAAAATCTTCCTAAATTATGTTFlanking genome sequence
(162854 - 162903) ----+----*----+----*----+----*----+----*----+----*
AAGAGGAAAATCTTTTTTATGATATAAAACAAAGCCAAACAAAGAAAAGC
Features of the protein sequence |
Description | |
---|---|---|
Length: 1157 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 16 |
: Genebridge 4 | |
: CAAGATGGAGATGGTCAGCAC | |
: TAGCATGGTCTTCCTCAGGTC | |
: 199 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |