HUGE

Gene/Protein Characteristic Table for KIAA0853

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07403
Accession No. :	AB020660
Description :	Zinc finger CCCH domain-containing protein 13.
HUGO Gene Name :
Clone Name :	hk06136 [Vector Info]
Flexi ORF Clone :	pF1KA0853
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4363 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1457 bp

Genome contig ID gi51511729r_45327819
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TTACTAAGTGTTTTGAATAAAGAAAAAAAAAATGT
Flanking genome sequence
(99987 - 99938)
----+----*----+----*----+----*----+----*----+----*
ATGACCTCAGAGAATGAATACCCTTCAGGAAGCCACTTCCTGATTTTAGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 13 r 45427806 45447783 8 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 967 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q5T200	0	99.9	Zinc finger CCC...	Homo sapiens
XP_001097211	0	98.0	zinc finger CCC...	Macaca mulatta
CAB66679	0	99.9	hypothetical pr...	Homo sapiens
CAM13064	0	99.8	zinc finger CCC...	Homo sapiens
BAG52030	9.9e-169	99.5	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018344	0.00016	26.7	KIAA0801
AB002322	0.00016	23.7	KIAA0324
D80004	0.00054	23.6	KIAA0182
AB014570	0.00094	21.9	KIAA0670

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGAAAATGGTTGTCACTGCTC

Primer_r
: ACATACCACGCCAGCTAGACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 13

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GATCATCCATACAGAACCAAC
Primer_r	: ACATACCACGCCAGCTAGACC
PCR product length	: 129 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1457 bp
Genome contig ID	gi51511729r_45327819
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTACTAAGTGTTTTGAATAAAGAAAAAAAAAATGT
Flanking genome sequence (99987 - 99938)	----+--------+--------+--------+--------+----* ATGACCTCAGAGAATGAATACCCTTCAGGAAGCCACTTCCTGATTTTAGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	13	r	45427806	45447783	8	99.8	Perfect prediction

Primer_f	: GGAAAATGGTTGTCACTGCTC
Primer_r	: ACATACCACGCCAGCTAGACC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0853

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information