HUGE

Gene/Protein Characteristic Table for KIAA0801

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB018344
Description :	Probable ATP-dependent RNA helicase DDX46.
HUGO Gene Name :	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46 (DDX46)
Clone Name :	hg03949 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6543 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
NO NO

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 497 bp

Genome contig ID gi51511721f_134022384
PolyA signal sequence
(AATAGA,-21)
+----*----+----*----+----*----+----
TTTAAGAATGTTATAATAGAAGTCTTACAAAATGG
Flanking genome sequence
(170410 - 170459)
----+----*----+----*----+----*----+----*----+----*
GTTGAGAGTTTTTGTTTCAATTTTTATCATCATAAATGGGCAAAAAGTAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 134122384 134192792 23 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1058 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_517939	99.8	DEAD (Asp-Glu-A...	Pan troglodytes
DAA00076	100.0	TPA_exp: Prp5-l...	Homo sapiens
BAF84477	99.9	unnamed protein...	Homo sapiens
Q5R6D8	99.8	Probable ATP-de...	Pongo abelii
Q7L014	99.9	Probable ATP-de...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D21853	1e-17	33.2	KIAA0111
AB046815	1.1e-07	32.3	KIAA1595
AB020660	2e-05	27.1	KIAA0853
AB002322	6.3e-05	36.2	KIAA0324
AB011108	0.00054	30.7	KIAA0536

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011545 422 596 PF00270 DNA/RNA helicase

IPR001650 664 740 PF00271 DNA/RNA helicase

HMMSmart IPR014001 417 622 SM00487 DEAD-like helicases

IPR001650 659 740 SM00490 DNA/RNA helicase

ProfileScan IPR014014 398 426 PS51195 RNA helicase

IPR014021 429 607 PS51192 Helicase

IPR001650 618 779 PS51194 DNA/RNA helicase

ScanRegExp IPR000629 553 561 PS00039 RNA helicase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011545	422	596	PF00270	DNA/RNA helicase
IPR001650	664	740	PF00271	DNA/RNA helicase
HMMSmart	IPR014001	417	622	SM00487	DEAD-like helicases
IPR001650	659	740	SM00490	DNA/RNA helicase
ProfileScan	IPR014014	398	426	PS51195	RNA helicase
IPR014021	429	607	PS51192	Helicase
IPR001650	618	779	PS51194	DNA/RNA helicase
ScanRegExp	IPR000629	553	561	PS00039	RNA helicase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCCGGCTGCAAAATTCATACC

Primer_r
: CCACATACATCATAGACCAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCCGGCTGCAAAATTCATACC
Primer_r	: CCACATACATCATAGACCAGC
PCR product length	: 104 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	NO	NO
Warning for coding interruption:	YES	NO

Length of 3'UTR	497 bp
Genome contig ID	gi51511721f_134022384
PolyA signal sequence (AATAGA,-21)	+--------+--------+----*----+---- TTTAAGAATGTTATAATAGAAGTCTTACAAAATGG
Flanking genome sequence (170410 - 170459)	----+--------+--------+--------+--------+----* GTTGAGAGTTTTTGTTTCAATTTTTATCATCATAAATGGGCAAAAAGTAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	134122384	134192792	23	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0801

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information