HUGE

Gene/Protein Characteristic Table for KIAA0111

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00412
Accession No. :	D21853
Description :	Eukaryotic initiation factor 4A-III.
HUGO Gene Name :	eukaryotic translation initiation factor 4A, isoform 3 (EIF4A3)
Clone Name :	ha00659 [Vector Info]
Flexi ORF Clone :	pF1KSDA0111
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 1682 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 232 bp

Genome contig ID gi51511734r_75623652
PolyA signal sequence
(ATTAAA,-25)
+----*----+----*----+----*----+----
AGTCTTTTTCATTAAAAATTTAAAACTTTTCCCAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAACTCTATACTTCTAAGGTGCCACCACCTTCTCTAGTAACTTACTGTGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 75723652 75735533 12 100.0 Terminal No-hit

Features of the protein sequence	Description

Length: 412 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P38919	1.9e-166	100.0	Eukaryotic init...	Homo sapiens
AAX29071	1.9e-166	100.0	DEAD box polype...	synthetic construct
2HYI	1.9e-166	100.0	Structure of th...	Synthetic construct
Q2NL22	4e-166	99.8	Eukaryotic init...	Bos taurus
XP_511724	5e-166	99.8	similar to DEAD...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018344	2.7e-44	33.4	KIAA0801
AB046815	1.4e-19	29.3	KIAA1595
AB023145	0.00026	24.7	KIAA0928

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011545 63 229 PF00270 DNA/RNA helicase

IPR001650 297 373 PF00271 DNA/RNA helicase

HMMSmart IPR014001 58 255 SM00487 DEAD-like helicases

IPR001650 292 373 SM00490 DNA/RNA helicase

ProfileScan IPR014014 39 67 PS51195 RNA helicase

IPR014021 70 240 PS51192 Helicase

IPR001650 251 412 PS51194 DNA/RNA helicase

ScanRegExp IPR000629 186 194 PS00039 RNA helicase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011545	63	229	PF00270	DNA/RNA helicase
IPR001650	297	373	PF00271	DNA/RNA helicase
HMMSmart	IPR014001	58	255	SM00487	DEAD-like helicases
IPR001650	292	373	SM00490	DNA/RNA helicase
ProfileScan	IPR014014	39	67	PS51195	RNA helicase
IPR014021	70	240	PS51192	Helicase
IPR001650	251	412	PS51194	DNA/RNA helicase
ScanRegExp	IPR000629	186	194	PS00039	RNA helicase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: Stanford G3
Primer_f	: ACGACATCCGCATCCTCAGAG
Primer_r	: GAACAGTCTCCCTCATCCCAC
PCR product length	: 119 (0.6k) bp
PCR conditions	: 95 °C15 sec68 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	232 bp
Genome contig ID	gi51511734r_75623652
PolyA signal sequence (ATTAAA,-25)	+--------+--------+----*----+---- AGTCTTTTTCATTAAAAATTTAAAACTTTTCCCAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACTCTATACTTCTAAGGTGCCACCACCTTCTCTAGTAACTTACTGTGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	75723652	75735533	12	100.0	Terminal No-hit

Gene/Protein Characteristic Table for KIAA0111

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information