HUGE |
Gene/Protein Characteristic Table for KIAA1595 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04733 |
---|---|
Accession No. : | AB046815 |
Description : | ATP-dependent RNA helicase DDX55. |
HUGO Gene Name : | DEAD (Asp-Glu-Ala-Asp) box polypeptide 55 (DDX55) |
Clone Name : | fj09517 [Vector Info] |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4033 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 331 bp Genome contig ID gi89161190f_122556961 PolyA signal sequence
(ATTAAA,-22) +----*----+----*----+----*----+----
GCGAGACCCTCTCATTAAAAACAACAAAACAAAACFlanking genome sequence
(114012 - 114061) ----+----*----+----*----+----*----+----*----+----*
AATTCCAGTCTTGGAGTAGTCTAACAGAAGAAAATGTAAAATTATTTGAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 f 122656881 122670971 9 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 471 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GAAGGGCGTGAAGATTATGTG | |
: ATTGCTGGGAGGGTCATACTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 12 |
: CCR | |
: GAAGGGCGTGAAGATTATGTG | |
: ATTGCTGGGAGGGTCATACTG | |
: 172(1.2k) bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |