HUGE

Gene/Protein Characteristic Table for KIAA0209

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01964
Accession No. :	D86964
Description :	Dedicator of cytokinesis protein 2.
HUGO Gene Name :	dedicator of cytokinesis 2 (DOCK2)
Clone Name :	ha04649 [Vector Info]
Flexi ORF Clone :	pF1KA0209
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 6050 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 519 bp

Genome contig ID gi51511721f_168896871
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
TTCTTACTGACAATAAAAAATGTTCTCTTGGTTCG
Flanking genome sequence
(546090 - 546139)
----+----*----+----*----+----*----+----*----+----*
AATAAGCCTTGTTGCCTGATTCTGTTGGCTGACTCTCCTGGGCCCAGGAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 168996871 169442959 52 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1842 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q92608	100.0	Dedicator of cy...	Homo sapiens
XP_527109	99.1	dedicator of cy...	Pan troglodytes
XP_001500151	95.7	dedicator of cy...	Equus caballus
CAI25210	95.1	dedicator of cy...	Mus musculus
Q8C3J5	95.0	Dedicator of cy...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002297	9.2e-101	38.7	KIAA0299
AB018259	8.6e-100	37.8	KIAA0716
AB037816	3e-06	24.4	KIAA1395

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001452 23 76 PD000066 Src homology-3

HMMPfam IPR011511 24 78 PF07653 Variant SH3

HMMSmart IPR001452 23 80 SM00326 Src homology-3

ProfileScan IPR001452 20 81 PS50002 Src homology-3

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	23	76	PD000066	Src homology-3
HMMPfam	IPR011511	24	78	PF07653	Variant SH3
HMMSmart	IPR001452	23	80	SM00326	Src homology-3
ProfileScan	IPR001452	20	81	PS50002	Src homology-3

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: AATCGGCTGAAGAAGGCAAAC
Primer_r	: TCTCTGTCTCCTCTAAGTAAG
PCR product length	: 189 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	519 bp
Genome contig ID	gi51511721f_168896871
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TTCTTACTGACAATAAAAAATGTTCTCTTGGTTCG
Flanking genome sequence (546090 - 546139)	----+--------+--------+--------+--------+----* AATAAGCCTTGTTGCCTGATTCTGTTGGCTGACTCTCCTGGGCCCAGGAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	168996871	169442959	52	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA0209

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information