HUGE |
Gene/Protein Characteristic Table for KIAA1395 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01688 |
---|---|
Accession No. : | AB037816 |
Description : | Dedicator of cytokinesis protein 6. |
HUGO Gene Name : | dedicator of cytokinesis 6 (DOCK6) |
Clone Name : | hj07927s1 [Vector Info] |
Flexi ORF Clone : | pF1KA1395
![]() |
Source : | Human adult brain |
Note : | We replaced hj07927, former representative clones for KIAA1395 with hj07927s1. (2002/12/27) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6356 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 200 bp Genome contig ID gi42406306r_11070973 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CCTCCCTTTTTTAATTTAAAATGGTTTTTATAAGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AACCTGTGCCATGTGGTGCGGTCACTAGGGGCTGGGTCACATGCTCATCA
Chr f/r start end exon identity class ContigView(URL based/DAS) 19 r 11170973 11234128 47 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 2051 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR010703 | 1843 | 2022 | PF06920 | Dedicator of cytokinesis |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GCAGGTCACCATGTCTCTCTC | |
: GTCAGGATCATGTGCAGGTTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 19 |
: GeneBridge 4 | |
: GCAGGTCACCATGTCTCTCTC | |
: GTCAGGATCATGTGCAGGTTG | |
: 177 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |