HUGE

Gene/Protein Characteristic Table for KIAA1395

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01688
Accession No. :	AB037816
Description :	Dedicator of cytokinesis protein 6.
HUGO Gene Name :	dedicator of cytokinesis 6 (DOCK6)
Clone Name :	hj07927s1 [Vector Info]
Flexi ORF Clone :	pF1KA1395
Source :	Human adult brain
Note :	We replaced hj07927, former representative clones for KIAA1395 with hj07927s1. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 6356 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 200 bp

Genome contig ID gi42406306r_11070973
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CCTCCCTTTTTTAATTTAAAATGGTTTTTATAAGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACCTGTGCCATGTGGTGCGGTCACTAGGGGCTGGGTCACATGCTCATCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 r 11170973 11234128 47 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 2051 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96HP0	100.0	Dedicator of cy...	Homo sapiens
NP_065863	100.0	dedicator of cy...	Homo sapiens
EAW84184	99.1	dedicator of cy...	Homo sapiens
XP_001916401	92.5	dedicator of cy...	Equus caballus
EAW84182	99.6	dedicator of cy...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051558	0	66.3	KIAA1771
AB028981	9.8e-32	30.6	KIAA1058
AB018259	3.1e-07	22.4	KIAA0716
D86964	1.1e-05	24.7	KIAA0209

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010703 1843 2022 PF06920 Dedicator of cytokinesis

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010703	1843	2022	PF06920	Dedicator of cytokinesis

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCAGGTCACCATGTCTCTCTC

Primer_r
: GTCAGGATCATGTGCAGGTTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCAGGTCACCATGTCTCTCTC
Primer_r	: GTCAGGATCATGTGCAGGTTG
PCR product length	: 177 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	200 bp
Genome contig ID	gi42406306r_11070973
PolyA signal sequence (None)	+--------+--------+----*----+---- CCTCCCTTTTTTAATTTAAAATGGTTTTTATAAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACCTGTGCCATGTGGTGCGGTCACTAGGGGCTGGGTCACATGCTCATCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	r	11170973	11234128	47	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA1395

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information